Transcript: Human NM_005266.6

Homo sapiens gap junction protein alpha 5 (GJA5), transcript variant A, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
GJA5 (2702)
Length:
3201
CDS:
145..1221

Additional Resources:

NCBI RefSeq record:
NM_005266.6
NBCI Gene record:
GJA5 (2702)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005266.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436151 GGTTTCATCCAGGTTCGTTAT pLKO_005 1075 CDS 100% 10.800 15.120 N GJA5 n/a
2 TRCN0000059808 CCAGTACTTCATCTACGGAAT pLKO.1 654 CDS 100% 4.050 5.670 N GJA5 n/a
3 TRCN0000443998 GGCTGATTTCCGGTGTGATAC pLKO_005 291 CDS 100% 10.800 7.560 N GJA5 n/a
4 TRCN0000059809 CCATGGCTATCATAGTGACAA pLKO.1 1146 CDS 100% 4.950 3.465 N GJA5 n/a
5 TRCN0000059812 CTTTAATCAGTGCCTGGAGAA pLKO.1 942 CDS 100% 4.050 2.835 N GJA5 n/a
6 TRCN0000059810 TGTCCTCTTCATATTCCGTAT pLKO.1 225 CDS 100% 4.050 2.835 N GJA5 n/a
7 TRCN0000059811 AGCAATAATATGGCCTCCCAA pLKO.1 994 CDS 100% 2.640 1.848 N GJA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005266.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00641 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00641 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470630 TATACCCCATATGAAACGGAAATC pLX_317 39% 100% 100% V5 n/a
Download CSV