Transcript: Human NM_005337.5

Homo sapiens NCK associated protein 1 like (NCKAP1L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
NCKAP1L (3071)
Length:
8980
CDS:
39..3422

Additional Resources:

NCBI RefSeq record:
NM_005337.5
NBCI Gene record:
NCKAP1L (3071)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005337.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112253 CCATGATTAACCCTGCTAATT pLKO.1 745 CDS 100% 13.200 18.480 N Nckap1l n/a
2 TRCN0000155408 CCGAAGACACATCAAAGTGAT pLKO.1 1292 CDS 100% 4.950 6.930 N NCKAP1L n/a
3 TRCN0000155755 CCATTTCTTATGGGTCCCATT pLKO.1 2838 CDS 100% 4.050 3.240 N NCKAP1L n/a
4 TRCN0000158159 CATGGAGGACAGCTTATGGAA pLKO.1 3622 3UTR 100% 3.000 2.400 N NCKAP1L n/a
5 TRCN0000156305 CCGAAACAGCACGCAACATTT pLKO.1 239 CDS 100% 13.200 9.240 N NCKAP1L n/a
6 TRCN0000112251 GCCATGATTAACCCTGCTAAT pLKO.1 744 CDS 100% 10.800 7.560 N Nckap1l n/a
7 TRCN0000155011 GCCATGATTAACCCTGCTAAT pLKO.1 744 CDS 100% 10.800 7.560 N NCKAP1L n/a
8 TRCN0000154548 GCAGATCTGTGGAAGAACAAT pLKO.1 3560 3UTR 100% 5.625 3.938 N NCKAP1L n/a
9 TRCN0000157099 GCCAAGGTGATGAACCTCATT pLKO.1 1572 CDS 100% 4.950 3.465 N NCKAP1L n/a
10 TRCN0000156790 GCGGATACTCATTGGCATGTA pLKO.1 491 CDS 100% 4.950 3.465 N NCKAP1L n/a
11 TRCN0000156953 GCTGAGAAATCGTAGAGCAGT pLKO.1 3586 3UTR 100% 2.640 1.848 N NCKAP1L n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5473 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000112254 CCAACATAGATGTCCGAAATA pLKO.1 226 CDS 100% 13.200 9.240 N Nckap1l n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5474 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005337.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.