Transcript: Human NM_005376.5

Homo sapiens MYCL proto-oncogene, bHLH transcription factor (MYCL), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
MYCL (4610)
Length:
1942
CDS:
30..740

Additional Resources:

NCBI RefSeq record:
NM_005376.5
NBCI Gene record:
MYCL (4610)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005376.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424145 TCTCCAGTTGGCTTTACTTTA pLKO_005 1067 3UTR 100% 13.200 18.480 N MYCL n/a
2 TRCN0000220173 CCTGTGCCACTAAACTACATT pLKO.1 1566 3UTR 100% 5.625 7.875 N MYCL n/a
3 TRCN0000220176 CAGGAACTACGCCTCCATCAT pLKO.1 368 CDS 100% 4.950 6.930 N MYCL n/a
4 TRCN0000220177 CCCAAGCGACTCGGGTAAGGA pLKO.1 602 CDS 100% 0.000 0.000 N MYCL n/a
5 TRCN0000415108 TGGCGCTTAGAGAGGACAATA pLKO_005 878 3UTR 100% 13.200 9.240 N MYCL n/a
6 TRCN0000427790 GAGGCTTAGAGATAGACAATC pLKO_005 1202 3UTR 100% 10.800 7.560 N MYCL n/a
7 TRCN0000416655 GCACGTGGGTGTGTTGGTAAA pLKO_005 775 3UTR 100% 10.800 7.560 N MYCL n/a
8 TRCN0000423140 TGTTGGTAAACAGTTTGGAAA pLKO_005 786 3UTR 100% 4.950 3.465 N MYCL n/a
9 TRCN0000220175 CATTGGCTCTTCTCAAGCTCT pLKO.1 692 CDS 100% 2.640 1.848 N MYCL n/a
10 TRCN0000220174 CGAGGACATCTGGAAGAAATT pLKO.1 197 CDS 100% 13.200 7.920 N MYCL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005376.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10980 pDONR223 100% 87.2% 87.2% None 1_90del n/a
2 ccsbBroad304_10980 pLX_304 0% 87.2% 87.2% V5 1_90del n/a
3 TRCN0000470501 TTTGTCGTAGTGGCAGAGCGTGAG pLX_317 70% 87.2% 87.2% V5 1_90del n/a
Download CSV