Transcript: Human NM_005429.5

Homo sapiens vascular endothelial growth factor C (VEGFC), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
VEGFC (7424)
Length:
2259
CDS:
612..1871

Additional Resources:

NCBI RefSeq record:
NM_005429.5
NBCI Gene record:
VEGFC (7424)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005429.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058503 CGCGACAAACACCTTCTTTAA pLKO.1 1049 CDS 100% 13.200 18.480 N VEGFC n/a
2 TRCN0000058505 CCAACCGAGAATTTGATGAAA pLKO.1 1600 CDS 100% 5.625 7.875 N VEGFC n/a
3 TRCN0000425238 CTACCTCAGCAAGACGTTATT pLKO_005 1148 CDS 100% 13.200 10.560 N VEGFC n/a
4 TRCN0000414706 ACCAATTACATGTGGAATAAT pLKO_005 1344 CDS 100% 15.000 10.500 N VEGFC n/a
5 TRCN0000429228 ATGACCAAACAGCCAAGATTT pLKO_005 2075 3UTR 100% 13.200 9.240 N VEGFC n/a
6 TRCN0000414522 GTCGTTGTGTCCCTTCATATT pLKO_005 1828 CDS 100% 13.200 9.240 N VEGFC n/a
7 TRCN0000058507 CAAACCAGTAACAATCAGTTT pLKO.1 1199 CDS 100% 4.950 3.465 N VEGFC n/a
8 TRCN0000058506 CCACCAAACATGCAGCTGTTA pLKO.1 1742 CDS 100% 4.950 3.465 N VEGFC n/a
9 TRCN0000058504 CCCACAAAGAACTAGACAGAA pLKO.1 1528 CDS 100% 4.950 2.970 N VEGFC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005429.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07127 pDONR223 100% 99.9% 99.7% None 1240A>C n/a
2 ccsbBroad304_07127 pLX_304 53.7% 99.9% 99.7% V5 1240A>C n/a
3 TRCN0000468000 AACGAGCTTTAACTCGGGGGACCG pLX_317 38.7% 99.9% 99.7% V5 1240A>C n/a
Download CSV