Transcript: Human NM_005436.5

Homo sapiens coiled-coil domain containing 6 (CCDC6), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CCDC6 (8030)
Length:
5727
CDS:
133..1557

Additional Resources:

NCBI RefSeq record:
NM_005436.5
NBCI Gene record:
CCDC6 (8030)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005436.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296910 GCCTACTCCTTCGCAACATTC pLKO_005 1512 CDS 100% 10.800 8.640 N CCDC6 n/a
2 TRCN0000296971 GAGTTCAAGCAGGCCTATATC pLKO_005 1212 CDS 100% 13.200 9.240 N CCDC6 n/a
3 TRCN0000083828 CGCTGTTTGGTATTTGGTATT pLKO.1 1814 3UTR 100% 10.800 7.560 N CCDC6 n/a
4 TRCN0000307673 CGCTGTTTGGTATTTGGTATT pLKO_005 1814 3UTR 100% 10.800 7.560 N CCDC6 n/a
5 TRCN0000262120 TAGAGCTGGAGACCTACAAAC pLKO_005 356 CDS 100% 10.800 7.560 N Ccdc6 n/a
6 TRCN0000083829 GCAACTTACATTAGAACAGTT pLKO.1 696 CDS 100% 4.950 3.465 N CCDC6 n/a
7 TRCN0000083831 GCAGGAATTTCAGGTCAACAA pLKO.1 630 CDS 100% 4.950 3.465 N CCDC6 n/a
8 TRCN0000291338 GCAGGAATTTCAGGTCAACAA pLKO_005 630 CDS 100% 4.950 3.465 N CCDC6 n/a
9 TRCN0000083830 GCTTAGAAATGGACGACGAAA pLKO.1 1115 CDS 100% 4.950 3.465 N CCDC6 n/a
10 TRCN0000307674 GCTTAGAAATGGACGACGAAA pLKO_005 1115 CDS 100% 4.950 3.465 N CCDC6 n/a
11 TRCN0000083832 GCAAGAGAACAAGGTGCTGAA pLKO.1 333 CDS 100% 4.050 2.835 N CCDC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005436.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07195 pDONR223 100% 99.7% 99.7% None 297G>T;1326G>A;1408C>A n/a
2 ccsbBroad304_07195 pLX_304 0% 99.7% 99.7% V5 297G>T;1326G>A;1408C>A n/a
3 TRCN0000478109 CATGATCTCCTACGGATAAGACCT pLX_317 22.3% 99.7% 99.7% V5 297G>T;1326G>A;1408C>A n/a
Download CSV