Transcript: Human NM_005460.4

Homo sapiens synuclein alpha interacting protein (SNCAIP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
SNCAIP (9627)
Length:
3577
CDS:
95..2854

Additional Resources:

NCBI RefSeq record:
NM_005460.4
NBCI Gene record:
SNCAIP (9627)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005460.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156434 CACAGGAATCGCTGATGTGTA pLKO.1 283 CDS 100% 4.950 6.930 N SNCAIP n/a
2 TRCN0000156954 GCGTAGGACATCTCAGAACTT pLKO.1 2509 CDS 100% 4.950 6.930 N SNCAIP n/a
3 TRCN0000280306 GCGTAGGACATCTCAGAACTT pLKO_005 2509 CDS 100% 4.950 6.930 N SNCAIP n/a
4 TRCN0000157213 GCCGAAGATGTGATACGCAAA pLKO.1 189 CDS 100% 4.050 5.670 N SNCAIP n/a
5 TRCN0000151778 CTGATGCCCTTTGGAAATTAT pLKO.1 2957 3UTR 100% 15.000 10.500 N SNCAIP n/a
6 TRCN0000280249 CTGATGCCCTTTGGAAATTAT pLKO_005 2957 3UTR 100% 15.000 10.500 N SNCAIP n/a
7 TRCN0000152132 CGCTAGCAAAGGAAAGAATAA pLKO.1 2824 CDS 100% 13.200 9.240 N SNCAIP n/a
8 TRCN0000154228 CCAGACTTAGAATCCCAGTAT pLKO.1 2363 CDS 100% 4.950 3.465 N SNCAIP n/a
9 TRCN0000280308 CCAGACTTAGAATCCCAGTAT pLKO_005 2363 CDS 100% 4.950 3.465 N SNCAIP n/a
10 TRCN0000152049 CTTTGGAAAGAGAACCATGAA pLKO.1 2999 3UTR 100% 4.950 3.465 N SNCAIP n/a
11 TRCN0000153512 CCTTGGTTGAATATGGAGCAA pLKO.1 1518 CDS 100% 2.640 1.848 N SNCAIP n/a
12 TRCN0000085374 GCCTTATTCATTACGCAGGTT pLKO.1 1359 CDS 100% 2.640 1.848 N Sncaip n/a
13 TRCN0000152655 GCCTTATTCATTACGCAGGTT pLKO.1 1359 CDS 100% 2.640 1.848 N SNCAIP n/a
14 TRCN0000280250 GCCTTATTCATTACGCAGGTT pLKO_005 1359 CDS 100% 2.640 1.848 N SNCAIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005460.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11395 pDONR223 100% 90.2% 90% None (many diffs) n/a
2 ccsbBroad304_11395 pLX_304 0% 90.2% 90% V5 (many diffs) n/a
3 TRCN0000476088 GCCCTACCTCTTATGCCTTCTACG pLX_317 11.1% 90.2% 90% V5 (many diffs) n/a
Download CSV