Transcript: Human NM_005499.3

Homo sapiens ubiquitin like modifier activating enzyme 2 (UBA2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
UBA2 (10054)
Length:
4005
CDS:
53..1975

Additional Resources:

NCBI RefSeq record:
NM_005499.3
NBCI Gene record:
UBA2 (10054)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005499.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284899 CTACTAAGGAATGGGCTAAAT pLKO_005 768 CDS 100% 13.200 18.480 N UBA2 n/a
2 TRCN0000272904 CTGATTGATCTGGATACTATT pLKO_005 188 CDS 100% 13.200 17.160 N UBA2 n/a
3 TRCN0000007474 CCTGACTATAATGTGGAATTT pLKO.1 347 CDS 100% 13.200 9.240 N UBA2 n/a
4 TRCN0000007471 GCTGCCCGAAACCATGTTAAT pLKO.1 410 CDS 100% 13.200 9.240 N UBA2 n/a
5 TRCN0000007470 GCTGTATTGAAAGTAGGAATA pLKO.1 2145 3UTR 100% 10.800 7.560 N UBA2 n/a
6 TRCN0000272905 GCTGTATTGAAAGTAGGAATA pLKO_005 2145 3UTR 100% 10.800 7.560 N UBA2 n/a
7 TRCN0000007472 GCACCAGATGTCCAAATTGAA pLKO.1 1481 CDS 100% 5.625 3.938 N UBA2 n/a
8 TRCN0000272902 GCACCAGATGTCCAAATTGAA pLKO_005 1481 CDS 100% 5.625 3.938 N UBA2 n/a
9 TRCN0000007473 GCTGGGTTGATAGTATTGGAA pLKO.1 1235 CDS 100% 3.000 2.100 N UBA2 n/a
10 TRCN0000272903 GCTGGGTTGATAGTATTGGAA pLKO_005 1235 CDS 100% 3.000 2.100 N UBA2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2747 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3533 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3533 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005499.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07539 pDONR223 100% 99.9% 100% None 1776A>G n/a
2 ccsbBroad304_07539 pLX_304 0% 99.9% 100% V5 1776A>G n/a
3 TRCN0000473116 TTCTGCAATGCAATCGGTGTTCCA pLX_317 18.7% 99.9% 100% V5 1776A>G n/a
Download CSV