Transcript: Human NM_005561.4

Homo sapiens lysosomal associated membrane protein 1 (LAMP1), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
LAMP1 (3916)
Length:
2701
CDS:
197..1450

Additional Resources:

NCBI RefSeq record:
NM_005561.4
NBCI Gene record:
LAMP1 (3916)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005561.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274852 CTGACATCAGGGCAGATATAG pLKO_005 624 CDS 100% 13.200 18.480 N LAMP1 n/a
2 TRCN0000274914 GTGCGTCAGCAGCAATGTTTA pLKO_005 270 CDS 100% 13.200 18.480 N LAMP1 n/a
3 TRCN0000029266 CACTCTCAATTTCACGAGAAA pLKO.1 496 CDS 100% 4.950 6.930 N LAMP1 n/a
4 TRCN0000029267 GAATGCAAGTTCTAGCCGGTT pLKO.1 1072 CDS 100% 2.160 3.024 N LAMP1 n/a
5 TRCN0000029264 CGGCAATTCCTACAAGTGCAA pLKO.1 1192 CDS 100% 2.640 2.112 N LAMP1 n/a
6 TRCN0000285264 CGGCAATTCCTACAAGTGCAA pLKO_005 1192 CDS 100% 2.640 2.112 N LAMP1 n/a
7 TRCN0000274913 CTATCGAAATGACGGTGTTAA pLKO_005 1611 3UTR 100% 13.200 9.240 N LAMP1 n/a
8 TRCN0000029265 CCTACAAGGAATCCAGTTGAA pLKO.1 1096 CDS 100% 4.950 3.465 N LAMP1 n/a
9 TRCN0000029268 TGCTGCCTTCTCAGTGAACTA pLKO.1 337 CDS 100% 4.950 3.465 N LAMP1 n/a
10 TRCN0000274915 TGCTGCCTTCTCAGTGAACTA pLKO_005 337 CDS 100% 4.950 3.465 N LAMP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005561.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00927 pDONR223 100% 99.9% 100% None 556C>A n/a
2 ccsbBroad304_00927 pLX_304 0% 99.9% 100% V5 556C>A n/a
3 TRCN0000475286 CACCACCAGAAGTTATCGCGGCTG pLX_317 6.8% 99.9% 100% V5 556C>A n/a
Download CSV