Transcript: Human NM_005588.3

Homo sapiens meprin A subunit alpha (MEP1A), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MEP1A (4224)
Length:
2893
CDS:
11..2251

Additional Resources:

NCBI RefSeq record:
NM_005588.3
NBCI Gene record:
MEP1A (4224)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005588.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428036 CATAGCAGCTGTACCGATTAA pLKO_005 64 CDS 100% 13.200 18.480 N MEP1A n/a
2 TRCN0000050906 GCACACATCTCCAGCGATAAA pLKO.1 1606 CDS 100% 13.200 18.480 N MEP1A n/a
3 TRCN0000428271 GGTCTGGACAGTCCGGAATTT pLKO_005 1312 CDS 100% 13.200 18.480 N MEP1A n/a
4 TRCN0000423817 GAGAGCTCATATATCATATTT pLKO_005 356 CDS 100% 15.000 10.500 N MEP1A n/a
5 TRCN0000427495 CCCTATGATTATGAGTCTTTG pLKO_005 623 CDS 100% 10.800 7.560 N MEP1A n/a
6 TRCN0000050903 CCGGGATGATTATGTGAACAT pLKO.1 523 CDS 100% 4.950 3.465 N MEP1A n/a
7 TRCN0000050907 GCTGAATGCTAAAGGAGCCAT pLKO.1 274 CDS 100% 2.640 1.848 N MEP1A n/a
8 TRCN0000031311 CGGGATGATTATGTGAACATT pLKO.1 524 CDS 100% 5.625 3.938 N Mep1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005588.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06576 pDONR223 100% 99.8% 99.7% None (many diffs) n/a
2 ccsbBroad304_06576 pLX_304 0% 99.8% 99.7% V5 (many diffs) n/a
3 TRCN0000474880 TACCGATGTCCTGATGTACACCAT pLX_317 11.8% 99.8% 99.7% V5 (many diffs) n/a
Download CSV