Transcript: Human NM_005622.4

Homo sapiens acyl-CoA synthetase medium chain family member 3 (ACSM3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
ACSM3 (6296)
Length:
2533
CDS:
164..1924

Additional Resources:

NCBI RefSeq record:
NM_005622.4
NBCI Gene record:
ACSM3 (6296)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005622.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434770 TATCCTCTGGCTATCGAATTG pLKO_005 1608 CDS 100% 10.800 15.120 N ACSM3 n/a
2 TRCN0000083242 CCTGCTTTCGATGTTAAGATT pLKO.1 1370 CDS 100% 5.625 7.875 N ACSM3 n/a
3 TRCN0000419964 CAAAGAGGAGATCGGGTAATT pLKO_005 515 CDS 100% 13.200 10.560 N ACSM3 n/a
4 TRCN0000420216 CAGACTGAAACGGTGCTAATC pLKO_005 1295 CDS 100% 10.800 8.640 N ACSM3 n/a
5 TRCN0000112486 CCCAGAAAGGTAGAATTTATT pLKO.1 1829 CDS 100% 15.000 10.500 N Acsm3 n/a
6 TRCN0000083241 CCTGGACCAATGGACTGATAA pLKO.1 355 CDS 100% 13.200 9.240 N ACSM3 n/a
7 TRCN0000083238 GCTGGAAAGAAACCTTCAAAT pLKO.1 383 CDS 100% 13.200 9.240 N ACSM3 n/a
8 TRCN0000419608 TATGGATAAAGATGGGTATTT pLKO_005 1555 CDS 100% 13.200 9.240 N ACSM3 n/a
9 TRCN0000083240 CCCTCAGATGTGATGTGGAAT pLKO.1 965 CDS 100% 4.950 3.465 N ACSM3 n/a
10 TRCN0000083239 CCTGATTACAAGTCACATGAT pLKO.1 1745 CDS 100% 4.950 3.465 N ACSM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005622.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11116 pDONR223 100% 72.2% 67.4% None (many diffs) n/a
2 ccsbBroad304_11116 pLX_304 0% 72.2% 67.4% V5 (many diffs) n/a
3 TRCN0000492316 CCACTCTCCTATCCTCATCATTTA pLX_317 23.6% 72.2% 67.4% V5 (many diffs) n/a
Download CSV