Transcript: Human NM_005672.5

Homo sapiens prostate stem cell antigen (PSCA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PSCA (8000)
Length:
982
CDS:
45..389

Additional Resources:

NCBI RefSeq record:
NM_005672.5
NBCI Gene record:
PSCA (8000)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005672.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245444 TGTGACACCGACTTGTGCAAC pLKO_005 276 CDS 100% 4.050 5.670 N PSCA n/a
2 TRCN0000245445 ACGCAAGTCTGACCATGTATG pLKO_005 503 3UTR 100% 10.800 7.560 N PSCA n/a
3 TRCN0000245448 TGCTGTGCTACTCCTGCAAAG pLKO_005 79 CDS 100% 6.000 4.200 N PSCA n/a
4 TRCN0000245447 GATGACTCACAGGACTACTAC pLKO_005 231 CDS 100% 4.950 3.465 N PSCA n/a
5 TRCN0000245446 GGGCAAGAAGAACATCACGTG pLKO_005 254 CDS 100% 2.160 1.512 N PSCA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005672.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11250 pDONR223 100% 92.1% 92.6% None 0_1ins27;285T>C;342C>A n/a
2 ccsbBroad304_11250 pLX_304 0% 92.1% 92.6% V5 0_1ins27;285T>C;342C>A n/a
3 TRCN0000478677 TTAGCGGAAAGTACGATTCTGTGT pLX_317 100% 92.1% 92.6% V5 0_1ins27;285T>C;342C>A n/a
Download CSV