Transcript: Human NM_005715.3

Homo sapiens uronyl 2-sulfotransferase (UST), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
UST (10090)
Length:
4496
CDS:
402..1622

Additional Resources:

NCBI RefSeq record:
NM_005715.3
NBCI Gene record:
UST (10090)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005715.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432253 AGCCTAATAACTTATCATTTG pLKO_005 1930 3UTR 100% 10.800 15.120 N UST n/a
2 TRCN0000034799 CCCTATTTATTCACTCGACAT pLKO.1 885 CDS 100% 4.050 5.670 N UST n/a
3 TRCN0000034802 CCACCTCCTAGTAAGGTACTA pLKO.1 678 CDS 100% 4.950 3.960 N UST n/a
4 TRCN0000034803 GAGCCAATCGACGATGAAGAA pLKO.1 1560 CDS 100% 4.950 3.960 N UST n/a
5 TRCN0000431765 GAACAAATGGAACTGATTAAA pLKO_005 843 CDS 100% 15.000 10.500 N UST n/a
6 TRCN0000424172 GAAGCGCAAGTTTGGACTTAA pLKO_005 1475 CDS 100% 13.200 9.240 N UST n/a
7 TRCN0000034800 CCTGGATATCAATGAGTGTAT pLKO.1 1079 CDS 100% 4.950 3.465 N UST n/a
8 TRCN0000034801 CCACTACGTCAAAGAGCAGTT pLKO.1 1445 CDS 100% 4.050 2.835 N UST n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005715.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02309 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02309 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476527 ATCGGCACTGATTAGATTTTTAGA pLX_317 17.5% 100% 100% V5 n/a
Download CSV