Transcript: Human NM_005737.3

Homo sapiens ADP ribosylation factor like GTPase 4C (ARL4C), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ARL4C (10123)
Length:
4024
CDS:
464..1042

Additional Resources:

NCBI RefSeq record:
NM_005737.3
NBCI Gene record:
ARL4C (10123)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005737.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293704 CCAAAGCGATGCTTCGAATTT pLKO_005 1163 3UTR 100% 13.200 18.480 N ARL4C n/a
2 TRCN0000048179 GTCCCTGCATATCGTCATGTT pLKO.1 499 CDS 100% 4.950 6.930 N ARL4C n/a
3 TRCN0000286332 GTCCCTGCATATCGTCATGTT pLKO_005 499 CDS 100% 4.950 6.930 N ARL4C n/a
4 TRCN0000381784 ACGGAATCTCTGCACCCAAAT pLKO_005 1189 3UTR 100% 10.800 8.640 N ARL4C n/a
5 TRCN0000381591 GGAGCTGCGAAGTCTGATTTA pLKO_005 1228 3UTR 100% 13.200 9.240 N ARL4C n/a
6 TRCN0000379171 GAGGGCATGGACAAGCTCTAT pLKO_005 971 CDS 100% 4.950 3.465 N Arl4c n/a
7 TRCN0000380747 GAGGGCATGGACAAGCTCTAT pLKO_005 971 CDS 100% 4.950 3.465 N ARL4C n/a
8 TRCN0000293763 CATCGGCTTCAACACCGAGAA pLKO_005 595 CDS 100% 4.050 2.835 N ARL4C n/a
9 TRCN0000048181 GCTCAAGTTCAACGAGTTCGT pLKO.1 559 CDS 100% 2.640 1.848 N ARL4C n/a
10 TRCN0000286331 GCTCAAGTTCAACGAGTTCGT pLKO_005 559 CDS 100% 2.640 1.848 N ARL4C n/a
11 TRCN0000048178 GCATATCGTCATGTTGGGCTT pLKO.1 505 CDS 100% 2.160 1.512 N ARL4C n/a
12 TRCN0000379838 GCCGGTGGCAGAGATTGAGAA pLKO_005 868 CDS 100% 1.650 1.155 N ARL4C n/a
13 TRCN0000048182 CGAGGGCATGGACAAGCTCTA pLKO.1 970 CDS 100% 1.350 0.945 N ARL4C n/a
14 TRCN0000048180 GATGATCCTGAAACGCAGGAA pLKO.1 994 CDS 100% 0.264 0.185 N ARL4C n/a
15 TRCN0000286258 GATGATCCTGAAACGCAGGAA pLKO_005 994 CDS 100% 0.264 0.185 N ARL4C n/a
16 TRCN0000054611 GCTCTATGAGATGATCCTGAA pLKO.1 985 CDS 100% 4.050 2.430 N Arl4c n/a
17 TRCN0000334004 GCTCTATGAGATGATCCTGAA pLKO_005 985 CDS 100% 4.050 2.430 N Arl4c n/a
18 TRCN0000380665 CATCATCTACGTGGTGGACTC pLKO_005 727 CDS 100% 2.250 1.350 N ARL4C n/a
19 TRCN0000348152 TCAACACCGAGAAGATCAAAC pLKO_005 603 CDS 100% 10.800 7.560 N Arl4c n/a
20 TRCN0000348087 ACCGGCTCAAGTTCAACGAAT pLKO_005 555 CDS 100% 4.950 3.465 N Arl4c n/a
21 TRCN0000054610 GCATCATCTACGTGGTGGATT pLKO.1 726 CDS 100% 4.950 2.970 N Arl4c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005737.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02321 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02321 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473856 GACATCCTTCTTCCGGAGAAATGT pLX_317 67.2% 100% 100% V5 n/a
Download CSV