Transcript: Human NM_005740.3

Homo sapiens dynein axonemal light chain 4 (DNAL4), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
DNAL4 (10126)
Length:
1474
CDS:
216..533

Additional Resources:

NCBI RefSeq record:
NM_005740.3
NBCI Gene record:
DNAL4 (10126)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005740.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178984 CTGATTATAAGCGACTGCAGA pLKO.1 247 CDS 100% 2.640 3.696 N DNAL4 n/a
2 TRCN0000438269 ACGCCCAGTGTGTGAACTTGA pLKO_005 675 3UTR 100% 4.950 3.960 N DNAL4 n/a
3 TRCN0000414460 TCTGGTCAGGCACTCGGACAT pLKO_005 275 CDS 100% 1.350 1.080 N DNAL4 n/a
4 TRCN0000150080 CCTTGTCATTAGTGGTCATAT pLKO.1 936 3UTR 100% 13.200 9.240 N DNAL4 n/a
5 TRCN0000219808 GTGTCACAGCCTGTGAGAAAT pLKO.1 331 CDS 100% 13.200 9.240 N DNAL4 n/a
6 TRCN0000433570 TTGTCTTTGTGTACCAGTTTC pLKO_005 647 3UTR 100% 10.800 7.560 N DNAL4 n/a
7 TRCN0000219809 GAACCTCCTCTACCTGTACTT pLKO.1 473 CDS 100% 4.950 3.465 N DNAL4 n/a
8 TRCN0000437549 GAGGTGGGAGATGAGATCTTC pLKO_005 809 3UTR 100% 4.950 3.465 N DNAL4 n/a
9 TRCN0000100287 TGAGAAATTCTCCAACAACAA pLKO.1 344 CDS 100% 4.950 3.465 N Dnal4 n/a
10 TRCN0000351740 TGAGAAATTCTCCAACAACAA pLKO_005 344 CDS 100% 4.950 3.465 N Dnal4 n/a
11 TRCN0000147873 GATCAAAGAGACAATGGACAA pLKO.1 383 CDS 100% 4.050 2.835 N DNAL4 n/a
12 TRCN0000437772 GGGCTTTGGGTTTGAGATCAC pLKO_005 440 CDS 100% 4.050 2.835 N DNAL4 n/a
13 TRCN0000376976 GTTTGAGATCACCCACGAGGT pLKO_005 449 CDS 100% 2.160 1.512 N Dnal4 n/a
14 TRCN0000100289 CTGTGAGAAATTCTCCAACAA pLKO.1 341 CDS 100% 4.950 2.970 N Dnal4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005740.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07556 pDONR223 100% 99.6% 100% None 36T>C n/a
2 ccsbBroad304_07556 pLX_304 0% 99.6% 100% V5 36T>C n/a
3 TRCN0000478317 GATACCTACCAGGCAGTCATCGCA pLX_317 81.1% 99.6% 100% V5 36T>C n/a
Download CSV