Transcript: Human NM_005802.5

Homo sapiens TOP1 binding arginine/serine rich protein (TOPORS), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TOPORS (10210)
Length:
4131
CDS:
151..3288

Additional Resources:

NCBI RefSeq record:
NM_005802.5
NBCI Gene record:
TOPORS (10210)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005802.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272772 CCATACGGTATTGACATATTT pLKO_005 3591 3UTR 100% 15.000 21.000 N TOPORS n/a
2 TRCN0000272825 GTCCTAAGGCCTTCGTATAAT pLKO_005 634 CDS 100% 15.000 21.000 N TOPORS n/a
3 TRCN0000007519 CCTGATTCTAAGTGTCCTATA pLKO.1 445 CDS 100% 10.800 15.120 N TOPORS n/a
4 TRCN0000007518 GCGATGTTAGTAGATGCTCAT pLKO.1 1730 CDS 100% 4.050 5.670 N TOPORS n/a
5 TRCN0000272774 AGACCCAAGAGCTGGATATTA pLKO_005 1349 CDS 100% 15.000 10.500 N TOPORS n/a
6 TRCN0000272773 GTGGCCGCTACAGGGATATTT pLKO_005 974 CDS 100% 15.000 10.500 N TOPORS n/a
7 TRCN0000007517 GCAGAAATAGAGATCGTTATT pLKO.1 2201 CDS 100% 13.200 9.240 N TOPORS n/a
8 TRCN0000272826 GCAGAAATAGAGATCGTTATT pLKO_005 2201 CDS 100% 13.200 9.240 N TOPORS n/a
9 TRCN0000007516 CCACTATGTAAACAGCCCTTT pLKO.1 565 CDS 100% 4.050 2.835 N TOPORS n/a
10 TRCN0000007515 CCCTTTGGACAGTCTTTATTT pLKO.1 3689 3UTR 100% 15.000 9.000 N TOPORS n/a
11 TRCN0000099114 GCTTGCCTTCACAGATTAGTT pLKO.1 1021 CDS 100% 5.625 3.938 N Topors n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005802.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.