Transcript: Human NM_005819.6

Homo sapiens syntaxin 6 (STX6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
STX6 (10228)
Length:
4810
CDS:
198..965

Additional Resources:

NCBI RefSeq record:
NM_005819.6
NBCI Gene record:
STX6 (10228)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005819.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379555 ATGCAACTGAATTGAGTATAA pLKO_005 439 CDS 100% 13.200 18.480 N STX6 n/a
2 TRCN0000059463 GCAGGCATTAGCTGAAAGAAA pLKO.1 530 CDS 100% 5.625 7.875 N STX6 n/a
3 TRCN0000291917 GCAGGCATTAGCTGAAAGAAA pLKO_005 530 CDS 100% 5.625 7.875 N STX6 n/a
4 TRCN0000380793 ACGAGCTTCTGGGTATGTTTC pLKO_005 1406 3UTR 100% 10.800 8.640 N STX6 n/a
5 TRCN0000380713 GTGCCATAGCCATCCTCTTTG pLKO_005 904 CDS 100% 10.800 8.640 N STX6 n/a
6 TRCN0000059465 GCACTGGAACAACAGATAAAT pLKO.1 595 CDS 100% 15.000 10.500 N STX6 n/a
7 TRCN0000307853 GCACTGGAACAACAGATAAAT pLKO_005 595 CDS 100% 15.000 10.500 N STX6 n/a
8 TRCN0000059467 CACAGCAACAAGGGAAGAAAT pLKO.1 305 CDS 100% 13.200 9.240 N STX6 n/a
9 TRCN0000291945 CACAGCAACAAGGGAAGAAAT pLKO_005 305 CDS 100% 13.200 9.240 N STX6 n/a
10 TRCN0000059466 GACAATGTGATGAAGAAACTT pLKO.1 843 CDS 100% 5.625 3.938 N STX6 n/a
11 TRCN0000291944 GACAATGTGATGAAGAAACTT pLKO_005 843 CDS 100% 5.625 3.938 N STX6 n/a
12 TRCN0000115079 CATCAGCATAGTTGAAGCAAA pLKO.1 398 CDS 100% 4.950 3.465 N Stx6 n/a
13 TRCN0000115077 CCATCAGCATAGTTGAAGCAA pLKO.1 397 CDS 100% 3.000 2.100 N Stx6 n/a
14 TRCN0000339679 CCATCAGCATAGTTGAAGCAA pLKO_005 397 CDS 100% 3.000 2.100 N Stx6 n/a
15 TRCN0000059464 GCATAGTTGAAGCAAATCCTA pLKO.1 403 CDS 100% 3.000 2.100 N STX6 n/a
16 TRCN0000291946 GCATAGTTGAAGCAAATCCTA pLKO_005 403 CDS 100% 3.000 2.100 N STX6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005819.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02362 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02362 pLX_304 0% 100% 100% V5 n/a
Download CSV