Transcript: Human NM_005843.6

Homo sapiens signal transducing adaptor molecule 2 (STAM2), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
STAM2 (10254)
Length:
5472
CDS:
122..1699

Additional Resources:

NCBI RefSeq record:
NM_005843.6
NBCI Gene record:
STAM2 (10254)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005843.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056777 GCCTGCTCAAACTTCATATTT pLKO.1 1447 CDS 100% 15.000 12.000 N STAM2 n/a
2 TRCN0000056774 GCACTGGACAAGACACTGTTT pLKO.1 1470 CDS 100% 4.950 3.960 N STAM2 n/a
3 TRCN0000380808 GAAGTACGTGCTGTGATTAAA pLKO_005 395 CDS 100% 15.000 10.500 N STAM2 n/a
4 TRCN0000306340 AGAAGTATGTTCCCGTGATTT pLKO_005 367 CDS 100% 13.200 9.240 N Stam2 n/a
5 TRCN0000306339 AGTCTGATATCTGCAACTATT pLKO_005 500 CDS 100% 13.200 9.240 N Stam2 n/a
6 TRCN0000306338 TTTAGCTTGCCAGCATATTTC pLKO_005 2249 3UTR 100% 13.200 9.240 N Stam2 n/a
7 TRCN0000056773 GCACGGAAAGTGAGAGCTTTA pLKO.1 731 CDS 100% 10.800 7.560 N STAM2 n/a
8 TRCN0000056776 CTACAGAAGATTGGAGTCTTA pLKO.1 186 CDS 100% 4.950 3.465 N STAM2 n/a
9 TRCN0000056775 GCACCAGTGTACTCAGTCTAT pLKO.1 1223 CDS 100% 4.950 3.465 N STAM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005843.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10452 pDONR223 100% 99.8% 99.6% None 1565A>C;1573C>A n/a
2 ccsbBroad304_10452 pLX_304 0% 99.8% 99.6% V5 1565A>C;1573C>A n/a
3 TRCN0000474493 GTTTCGCGACTGAAGTTATGTAAA pLX_317 26% 99.8% 99.6% V5 1565A>C;1573C>A n/a
Download CSV