Transcript: Human NM_005861.4

Homo sapiens STIP1 homology and U-box containing protein 1 (STUB1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
STUB1 (10273)
Length:
1340
CDS:
117..1028

Additional Resources:

NCBI RefSeq record:
NM_005861.4
NBCI Gene record:
STUB1 (10273)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005861.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007528 GCAGTCTGTGAAGGCGCACTT pLKO.1 389 CDS 100% 1.350 1.890 N STUB1 n/a
2 TRCN0000352832 GCAGTCTGTGAAGGCGCACTT pLKO_005 389 CDS 100% 1.350 1.890 N STUB1 n/a
3 TRCN0000007529 CGCGAAGAAGAAGCGCTGGAA pLKO.1 539 CDS 100% 0.880 0.704 N STUB1 n/a
4 TRCN0000280055 CGCGAAGAAGAAGCGCTGGAA pLKO_005 539 CDS 100% 0.880 0.704 N STUB1 n/a
5 TRCN0000007527 GACGCATTCATCTCTGAGAAT pLKO.1 987 CDS 100% 4.950 3.465 N STUB1 n/a
6 TRCN0000007525 CCCAAGTTCTGCTGTTGGACT pLKO.1 1129 3UTR 100% 2.640 1.848 N STUB1 n/a
7 TRCN0000280056 CCCAAGTTCTGCTGTTGGACT pLKO_005 1129 3UTR 100% 2.640 1.848 N STUB1 n/a
8 TRCN0000007526 GAAGAGGAAGAAGCGAGACAT pLKO.1 776 CDS 100% 4.950 2.970 N STUB1 n/a
9 TRCN0000280054 GAAGAGGAAGAAGCGAGACAT pLKO_005 776 CDS 100% 4.950 2.970 N STUB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005861.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02378 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02378 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473437 CCGTTTCTACAGCTCATCCCAGGC pLX_317 53.7% 100% 100% V5 n/a
Download CSV