Transcript: Human NM_005871.4

Homo sapiens survival motor neuron domain containing 1 (SMNDC1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SMNDC1 (10285)
Length:
4310
CDS:
174..890

Additional Resources:

NCBI RefSeq record:
NM_005871.4
NBCI Gene record:
SMNDC1 (10285)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005871.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001137 CAGTGTTATGAAGCGGAGATT pLKO.1 435 CDS 100% 4.950 6.930 N SMNDC1 n/a
2 TRCN0000349546 CAGTGTTATGAAGCGGAGATT pLKO_005 435 CDS 100% 4.950 6.930 N SMNDC1 n/a
3 TRCN0000001138 CTGGTAAAGTTGGAGTAGGAA pLKO.1 790 CDS 100% 3.000 4.200 N SMNDC1 n/a
4 TRCN0000318367 CTGGTAAAGTTGGAGTAGGAA pLKO_005 790 CDS 100% 3.000 4.200 N SMNDC1 n/a
5 TRCN0000369078 GAAAGTGAAATGGCAACAATT pLKO_005 695 CDS 100% 13.200 9.240 N SMNDC1 n/a
6 TRCN0000377256 GATTGCCCAGCAGCGTGAATA pLKO_005 608 CDS 100% 13.200 9.240 N SMNDC1 n/a
7 TRCN0000123798 GCCAGGTAAAGAGGAGTATTT pLKO.1 748 CDS 100% 13.200 9.240 N Smndc1 n/a
8 TRCN0000010599 CGTCATTGGTTGGCTTCAGTA pLKO.1 1001 3UTR 100% 4.950 3.465 N SMNDC1 n/a
9 TRCN0000001139 GAAGCGGAGATTGAGGAGATA pLKO.1 444 CDS 100% 4.950 3.465 N SMNDC1 n/a
10 TRCN0000001136 GCTTCTACTCAACCTACTCAT pLKO.1 366 CDS 100% 4.950 3.465 N SMNDC1 n/a
11 TRCN0000318422 GCTTCTACTCAACCTACTCAT pLKO_005 366 CDS 100% 4.950 3.465 N SMNDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005871.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02384 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02384 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468163 CTCTGACGGGGTCTTTAGATCTCT pLX_317 54.7% 100% 100% V5 n/a
Download CSV