Transcript: Human NM_005879.3

Homo sapiens TRAF interacting protein (TRAIP), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TRAIP (10293)
Length:
2023
CDS:
112..1521

Additional Resources:

NCBI RefSeq record:
NM_005879.3
NBCI Gene record:
TRAIP (10293)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005879.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033740 CCCAGCATGGTTACTACGAAA pLKO.1 1106 CDS 100% 4.950 3.465 N TRAIP n/a
2 TRCN0000291848 CCCAGCATGGTTACTACGAAA pLKO_005 1106 CDS 100% 4.950 3.465 N TRAIP n/a
3 TRCN0000033739 CCGTGATGATATTGATCTCAA pLKO.1 1041 CDS 100% 4.950 3.465 N TRAIP n/a
4 TRCN0000291847 CCGTGATGATATTGATCTCAA pLKO_005 1041 CDS 100% 4.950 3.465 N TRAIP n/a
5 TRCN0000033742 GCCTACTGACACAGTCATGAT pLKO.1 1395 CDS 100% 4.950 3.465 N TRAIP n/a
6 TRCN0000033741 GCAGTGCCTAATTCAGTGGTT pLKO.1 204 CDS 100% 2.640 1.848 N TRAIP n/a
7 TRCN0000291849 GCAGTGCCTAATTCAGTGGTT pLKO_005 204 CDS 100% 2.640 1.848 N TRAIP n/a
8 TRCN0000033743 GCAGACAGTCTACTCTGAATT pLKO.1 819 CDS 100% 0.000 0.000 N TRAIP n/a
9 TRCN0000291846 GCAGACAGTCTACTCTGAATT pLKO_005 819 CDS 100% 0.000 0.000 N TRAIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005879.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02389 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02389 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471083 TTCCTTTTAAACTTCACAAGGGCC pLX_317 35.3% 100% 100% V5 n/a
Download CSV