Transcript: Human NM_005905.6

Homo sapiens SMAD family member 9 (SMAD9), transcript variant b, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SMAD9 (4093)
Length:
5447
CDS:
310..1602

Additional Resources:

NCBI RefSeq record:
NM_005905.6
NBCI Gene record:
SMAD9 (4093)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005905.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019446 CACGGCTTTGAAGTCGTGTAT pLKO.1 1396 CDS 100% 4.950 6.930 N SMAD9 n/a
2 TRCN0000019445 CGACCCTTCAAATAACAGGAA pLKO.1 1104 CDS 100% 2.640 3.696 N SMAD9 n/a
3 TRCN0000412684 GCGATATTGTCAACAGTATTT pLKO_005 1856 3UTR 100% 13.200 10.560 N SMAD9 n/a
4 TRCN0000019447 GCAGAAAGAAGTGTGCATTAA pLKO.1 669 CDS 100% 13.200 9.240 N SMAD9 n/a
5 TRCN0000434453 GTCTTAACAGTCATGTCTTAA pLKO_005 1596 CDS 100% 13.200 9.240 N SMAD9 n/a
6 TRCN0000019444 CCCTATCAACACTCAGACTTT pLKO.1 964 CDS 100% 4.950 3.465 N SMAD9 n/a
7 TRCN0000019448 CGTGTATGAACTGACCAAGAT pLKO.1 1410 CDS 100% 4.950 3.465 N SMAD9 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4035 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4035 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005905.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00965 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00965 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480230 TCTCGAACATTAGCTTCACAAGTC pLX_317 30.1% 100% 100% V5 n/a
Download CSV