Transcript: Human NM_005924.5

Homo sapiens mesenchyme homeobox 2 (MEOX2), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
MEOX2 (4223)
Length:
2371
CDS:
282..1196

Additional Resources:

NCBI RefSeq record:
NM_005924.5
NBCI Gene record:
MEOX2 (4223)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005924.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418137 GCATGCGCACTTATGATATAA pLKO_005 1181 CDS 100% 15.000 21.000 N MEOX2 n/a
2 TRCN0000018254 CGATACGAGATAGCAGTGAAT pLKO.1 930 CDS 100% 4.950 6.930 N MEOX2 n/a
3 TRCN0000427218 CATCAGAGCTGTCGGGAATTG pLKO_005 1087 CDS 100% 10.800 8.640 N MEOX2 n/a
4 TRCN0000433531 GCCTTACCCAAATATCGTTTA pLKO_005 1248 3UTR 100% 10.800 7.560 N MEOX2 n/a
5 TRCN0000018255 CCCAACGAAGAGGGCATGTTT pLKO.1 441 CDS 100% 5.625 3.938 N MEOX2 n/a
6 TRCN0000018253 GCATTCATATTAGCTGATGAA pLKO.1 1785 3UTR 100% 0.495 0.347 N MEOX2 n/a
7 TRCN0000070613 GCAGAATTTGCCCATCATAAT pLKO.1 891 CDS 100% 13.200 7.920 N Meox2 n/a
8 TRCN0000018256 CCATGGAAGATCTGACCATAT pLKO.1 368 CDS 100% 10.800 6.480 N MEOX2 n/a
9 TRCN0000018257 TCTCACTGAAAGACAGGTGAA pLKO.1 956 CDS 100% 4.050 2.430 N MEOX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005924.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10965 pDONR223 100% 99.6% 99.6% None 202_204delCAC n/a
2 ccsbBroad304_10965 pLX_304 0% 99.6% 99.6% V5 202_204delCAC n/a
3 TRCN0000479953 ACCTTGCCGGTCCCAGTAATTCAA pLX_317 44.1% 99.6% 99.6% V5 202_204delCAC n/a
Download CSV