Transcript: Human NM_006022.4

Homo sapiens TSC22 domain family member 1 (TSC22D1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TSC22D1 (8848)
Length:
3148
CDS:
231..665

Additional Resources:

NCBI RefSeq record:
NM_006022.4
NBCI Gene record:
TSC22D1 (8848)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006022.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086181 GAGTTTACCAACTGAGACATT pLKO.1 271 CDS 100% 4.950 6.930 N Tsc22d1 n/a
2 TRCN0000301933 GAGTTTACCAACTGAGACATT pLKO_005 271 CDS 100% 4.950 6.930 N Tsc22d1 n/a
3 TRCN0000013291 GCAAGCTATGGATCTAGTGAA pLKO.1 398 CDS 100% 4.950 6.930 N TSC22D1 n/a
4 TRCN0000234089 AGTTTACCAACTGAGACATTT pLKO_005 272 CDS 100% 13.200 9.240 N Tsc22d1 n/a
5 TRCN0000329864 AGTTTACCAACTGAGACATTT pLKO_005 272 CDS 100% 13.200 9.240 N TSC22D1 n/a
6 TRCN0000013290 CGCTTCTGTGAGACTTGATAA pLKO.1 332 CDS 100% 13.200 9.240 N TSC22D1 n/a
7 TRCN0000329849 CGCTTCTGTGAGACTTGATAA pLKO_005 332 CDS 100% 13.200 9.240 N TSC22D1 n/a
8 TRCN0000329929 GAGCAAATCAAAGAACTAATA pLKO_005 465 CDS 100% 13.200 9.240 N TSC22D1 n/a
9 TRCN0000329852 GGTGCAAGTGTGGTAGCTATT pLKO_005 363 CDS 100% 10.800 7.560 N TSC22D1 n/a
10 TRCN0000013288 GCCTCTTTCTTCTCAAACAAT pLKO.1 1202 3UTR 100% 5.625 3.938 N TSC22D1 n/a
11 TRCN0000329850 GCCTCTTTCTTCTCAAACAAT pLKO_005 1202 3UTR 100% 5.625 3.938 N TSC22D1 n/a
12 TRCN0000013292 GTCCTCAAAGAGCAAATCAAA pLKO.1 456 CDS 100% 5.625 3.938 N TSC22D1 n/a
13 TRCN0000013289 GCAGGAGAACAATCTGCTGAA pLKO.1 506 CDS 100% 4.050 2.835 N TSC22D1 n/a
14 TRCN0000374229 GGTGCAAGTGTGGTAGCTATC pLKO_005 363 CDS 100% 6.000 4.200 N Tsc22d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006022.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02032 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02032 pLX_304 0% 100% 100% V5 n/a
Download CSV