Transcript: Human NM_006057.3

Homo sapiens beta-1,3-galactosyltransferase 5 (B3GALT5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
B3GALT5 (10317)
Length:
13005
CDS:
428..1360

Additional Resources:

NCBI RefSeq record:
NM_006057.3
NBCI Gene record:
B3GALT5 (10317)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006057.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434208 AGGATTTCCTAGACGTCTATT pLKO_005 792 CDS 100% 13.200 18.480 N B3GALT5 n/a
2 TRCN0000437213 AGGCACATCCGGACAAGTTTC pLKO_005 1372 3UTR 100% 10.800 15.120 N B3GALT5 n/a
3 TRCN0000034798 GTCCCATACATTAAACTGGAA pLKO.1 1133 CDS 100% 2.640 3.696 N B3GALT5 n/a
4 TRCN0000034795 GCAAGTGGTTTGTCAGTAAAT pLKO.1 1014 CDS 100% 13.200 9.240 N B3GALT5 n/a
5 TRCN0000034797 CAGTCCTTTGTTTACAAGAAA pLKO.1 527 CDS 100% 5.625 3.938 N B3GALT5 n/a
6 TRCN0000034794 CCTTTCAAAGAACAGTCCTTT pLKO.1 515 CDS 100% 4.950 3.465 N B3GALT5 n/a
7 TRCN0000034796 CGAAAGGCTGAACATCAGATT pLKO.1 1177 CDS 100% 4.950 3.465 N B3GALT5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006057.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07586 pDONR223 100% 99.6% 99.6% None 254T>C;318G>A;576G>A n/a
2 ccsbBroad304_07586 pLX_304 0% 99.6% 99.6% V5 254T>C;318G>A;576G>A n/a
3 TRCN0000481199 TCTAAGTCCGCGAATGTAATAGGT pLX_317 49.6% 99.6% 99.6% V5 254T>C;318G>A;576G>A n/a
Download CSV