Transcript: Human NM_006101.3

Homo sapiens NDC80 kinetochore complex component (NDC80), mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
NDC80 (10403)
Length:
2126
CDS:
137..2065

Additional Resources:

NCBI RefSeq record:
NM_006101.3
NBCI Gene record:
NDC80 (10403)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006101.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421656 CAAGGACCCGAGACCACTTAA pLKO_005 376 CDS 100% 13.200 18.480 N NDC80 n/a
2 TRCN0000107941 CCCGGAATAGTCAACTTGGTA pLKO.1 333 CDS 100% 3.000 4.200 N NDC80 n/a
3 TRCN0000107942 CCGGAATAGTCAACTTGGTAT pLKO.1 334 CDS 100% 4.950 3.960 N NDC80 n/a
4 TRCN0000414191 GAATTGCAGCAGACTATTAAT pLKO_005 1259 CDS 100% 15.000 10.500 N NDC80 n/a
5 TRCN0000107940 GCAGACATTGAGCGAATAAAT pLKO.1 1226 CDS 100% 15.000 10.500 N NDC80 n/a
6 TRCN0000107943 GCCATTCTTGACCAGAAATTA pLKO.1 1100 CDS 100% 15.000 10.500 N NDC80 n/a
7 TRCN0000305154 TGAATTGCAGCAGACTATTAA pLKO_005 1258 CDS 100% 15.000 10.500 N Ndc80 n/a
8 TRCN0000088004 GCATTCATTCAGCAGTGTATT pLKO.1 404 CDS 100% 13.200 9.240 N LOC433869 n/a
9 TRCN0000433346 TGAGAAGAAAGCTACTCTAAT pLKO_005 2026 CDS 100% 13.200 9.240 N NDC80 n/a
10 TRCN0000107944 GCTCAAGTTTATGTACCTCTT pLKO.1 1499 CDS 100% 4.050 2.835 N NDC80 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006101.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02420 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02420 pLX_304 0% 100% 100% V5 n/a
Download CSV