Transcript: Human NM_006144.4

Homo sapiens granzyme A (GZMA), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GZMA (3001)
Length:
896
CDS:
38..826

Additional Resources:

NCBI RefSeq record:
NM_006144.4
NBCI Gene record:
GZMA (3001)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006144.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006453 CGCGAAGGTGACCTTAAACTT pLKO.1 368 CDS 100% 5.625 7.875 N GZMA n/a
2 TRCN0000378712 GTGGAAGAGACTCGTGCAATG pLKO_005 645 CDS 100% 6.000 4.800 N GZMA n/a
3 TRCN0000006451 CCTCTCTCTCAGTTGTCGTTT pLKO.1 66 CDS 100% 4.950 3.960 N GZMA n/a
4 TRCN0000006454 CGATACTCTGAGAGAAGTCAA pLKO.1 526 CDS 100% 4.950 3.960 N GZMA n/a
5 TRCN0000006450 CCCTGTGATTGGAATGAATAT pLKO.1 601 CDS 100% 13.200 9.240 N GZMA n/a
6 TRCN0000378778 ACCCTACATGGTCCTACTTAG pLKO_005 157 CDS 100% 10.800 7.560 N GZMA n/a
7 TRCN0000378757 TGCTTGTTAAGAAAGAGTTTC pLKO_005 321 CDS 100% 10.800 7.560 N GZMA n/a
8 TRCN0000006452 GCTCACTGTAACTTGAACAAA pLKO.1 239 CDS 100% 5.625 3.938 N GZMA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006144.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06346 pDONR223 100% 99.6% 99.2% None 13T>A;362T>C;420C>T n/a
2 ccsbBroad304_06346 pLX_304 0% 99.6% 99.2% V5 13T>A;362T>C;420C>T n/a
3 TRCN0000471542 TTACAGCTTGTACGCCGGGCGTCG pLX_317 63.1% 99.6% 99.2% V5 13T>A;362T>C;420C>T n/a
Download CSV