Transcript: Human NM_006158.4

Homo sapiens neurofilament light (NEFL), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
NEFL (4747)
Length:
3854
CDS:
355..1986

Additional Resources:

NCBI RefSeq record:
NM_006158.4
NBCI Gene record:
NEFL (4747)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006158.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083660 CGGTTTACAGACCAGCTCCTA pLKO.1 1629 CDS 100% 2.640 2.112 N NEFL n/a
2 TRCN0000083659 CAGGACACGATCAACAAATTA pLKO.1 1396 CDS 100% 15.000 10.500 N NEFL n/a
3 TRCN0000431300 CCTTAAAGATGGCACCAATAT pLKO_005 2454 3UTR 100% 13.200 9.240 N NEFL n/a
4 TRCN0000433316 GTGAAGATGGCTTTGGATATT pLKO_005 1486 CDS 100% 13.200 9.240 N NEFL n/a
5 TRCN0000433118 AGGAATAATTCTCCCGAAATC pLKO_005 2010 3UTR 100% 10.800 7.560 N NEFL n/a
6 TRCN0000083658 CGACAGCTTGATGGACGAAAT pLKO.1 993 CDS 100% 10.800 7.560 N NEFL n/a
7 TRCN0000416180 TCCAGCTCTGGATCGTTGATG pLKO_005 529 CDS 100% 4.950 3.465 N NEFL n/a
8 TRCN0000083662 CCGTCCTACTACACCAGCCAT pLKO.1 1672 CDS 100% 0.880 0.616 N NEFL n/a
9 TRCN0000083661 CCGCACGCTCAGCTTACTCAA pLKO.1 458 CDS 100% 1.650 1.320 N NEFL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006158.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10993 pDONR223 100% 52.2% 51.9% None (many diffs) n/a
2 ccsbBroad304_10993 pLX_304 0% 52.2% 51.9% V5 (many diffs) n/a
3 TRCN0000470653 GTTCATTCAGCCAGTCCCTTCGAA pLX_317 53.5% 52.2% 51.9% V5 (many diffs) n/a
Download CSV