Transcript: Human NM_006187.4

Homo sapiens 2'-5'-oligoadenylate synthetase 3 (OAS3), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
OAS3 (4940)
Length:
6599
CDS:
58..3321

Additional Resources:

NCBI RefSeq record:
NM_006187.4
NBCI Gene record:
OAS3 (4940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006187.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320372 GGTGAACAAGGCCGTTGATAC pLKO_005 2373 CDS 100% 10.800 15.120 N OAS3 n/a
2 TRCN0000005014 CGTTGATACCATCTGTTCATT pLKO.1 2385 CDS 100% 5.625 4.500 N OAS3 n/a
3 TRCN0000005016 CCAAGCCACAAGTCTACTCTA pLKO.1 542 CDS 100% 4.950 3.960 N OAS3 n/a
4 TRCN0000005015 GCCATGAGAATGCACCTTCTT pLKO.1 2101 CDS 100% 4.950 3.960 N OAS3 n/a
5 TRCN0000320373 TCTACTGGACGGTCAACTATA pLKO_005 2066 CDS 100% 13.200 9.240 N OAS3 n/a
6 TRCN0000320371 GAAGAGCTGGACGGATGTTAG pLKO_005 1668 CDS 100% 10.800 7.560 N OAS3 n/a
7 TRCN0000320444 GGCAGTTCGAGGTCAAGTTTG pLKO_005 2618 CDS 100% 10.800 7.560 N OAS3 n/a
8 TRCN0000005013 CGGAGGAACTTTGTGAACATT pLKO.1 619 CDS 100% 5.625 3.938 N OAS3 n/a
9 TRCN0000320370 CGGAGGAACTTTGTGAACATT pLKO_005 619 CDS 100% 5.625 3.938 N OAS3 n/a
10 TRCN0000005012 CCCATGCAAATTAGCTCACAT pLKO.1 3669 3UTR 100% 4.950 3.465 N OAS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006187.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.