Transcript: Human NM_006261.4

Homo sapiens PROP paired-like homeobox 1 (PROP1), mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
PROP1 (5626)
Length:
1464
CDS:
310..990

Additional Resources:

NCBI RefSeq record:
NM_006261.4
NBCI Gene record:
PROP1 (5626)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006261.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016164 CCGCAGAGCTAAGCAACGGAA pLKO.1 666 CDS 100% 0.880 1.232 N PROP1 n/a
2 TRCN0000435796 AGGTGAGGGCCTTCATTAATT pLKO_005 1289 3UTR 100% 15.000 10.500 N PROP1 n/a
3 TRCN0000419006 TGAGGGTCAGCTCAGCGATTA pLKO_005 1095 3UTR 100% 10.800 7.560 N PROP1 n/a
4 TRCN0000432009 AGCCTTTGGGAGGAACCAGTA pLKO_005 567 CDS 100% 4.050 2.835 N PROP1 n/a
5 TRCN0000016166 TGAGCCATCCAAGTCCTGGAA pLKO.1 966 CDS 100% 2.640 1.848 N PROP1 n/a
6 TRCN0000016165 CCCTATTCTTACGCAGCACCA pLKO.1 769 CDS 100% 2.160 1.512 N PROP1 n/a
7 TRCN0000016167 CCTACAGCCATGCCCTCCCTT pLKO.1 818 CDS 100% 0.000 0.000 N PROP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006261.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06780 pDONR223 100% 99.8% 99.5% None 35C>T n/a
2 ccsbBroad304_06780 pLX_304 0% 99.8% 99.5% V5 35C>T n/a
Download CSV