Transcript: Human NM_006317.5

Homo sapiens brain abundant membrane attached signal protein 1 (BASP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
BASP1 (10409)
Length:
1807
CDS:
190..873

Additional Resources:

NCBI RefSeq record:
NM_006317.5
NBCI Gene record:
BASP1 (10409)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006317.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147603 GCACCTGTAGTTCTGTTTATT pLKO.1 1572 3UTR 100% 15.000 12.000 N BASP1 n/a
2 TRCN0000281254 GCACCTGTAGTTCTGTTTATT pLKO_005 1572 3UTR 100% 15.000 12.000 N BASP1 n/a
3 TRCN0000281334 ACCAAACCGTAACCGTGAAAG pLKO_005 848 CDS 100% 10.800 7.560 N BASP1 n/a
4 TRCN0000281335 ACAAGGACAGCCTATAGGAAA pLKO_005 873 CDS 100% 4.950 2.970 N BASP1 n/a
5 TRCN0000149347 GAAAGCCAAGGAGAAAGACAA pLKO.1 240 CDS 100% 4.950 2.970 N BASP1 n/a
6 TRCN0000180477 GACGAGAAAGCCAAGGAGAAA pLKO.1 235 CDS 100% 4.950 2.970 N BASP1 n/a
7 TRCN0000281253 GACGAGAAAGCCAAGGAGAAA pLKO_005 235 CDS 100% 4.950 2.970 N BASP1 n/a
8 TRCN0000148376 CTACAATGTGAACGACGAGAA pLKO.1 222 CDS 100% 4.050 2.025 Y BASP1 n/a
9 TRCN0000250263 CTACAATGTGAACGACGAGAA pLKO_005 222 CDS 100% 4.050 2.025 Y Basp1 n/a
10 TRCN0000281321 CTACAATGTGAACGACGAGAA pLKO_005 222 CDS 100% 4.050 2.025 Y BASP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006317.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.