Transcript: Human NM_006398.4

Homo sapiens ubiquitin D (UBD), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
UBD (10537)
Length:
894
CDS:
32..529

Additional Resources:

NCBI RefSeq record:
NM_006398.4
NBCI Gene record:
UBD (10537)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006398.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007590 CGAGACTAAGACGGGTATAAT pLKO.1 388 CDS 100% 15.000 21.000 N UBD n/a
2 TRCN0000432975 AGAACATGTCCGGTCTAAGAC pLKO_005 133 CDS 100% 4.950 6.930 N UBD n/a
3 TRCN0000007593 GCTGGGCTCCAAGATCTTAAA pLKO.1 184 CDS 100% 13.200 9.240 N UBD n/a
4 TRCN0000418317 CATCTTATGGCATTGACAAAG pLKO_005 222 CDS 100% 10.800 7.560 N UBD n/a
5 TRCN0000430739 GAATGAGATGAGTAGAGTAAG pLKO_005 629 3UTR 100% 10.800 7.560 N UBD n/a
6 TRCN0000432412 GCATCAGAAAGGGCAACTTAC pLKO_005 477 CDS 100% 10.800 7.560 N UBD n/a
7 TRCN0000427934 GAGTCAGGTGATGAGGCAAAG pLKO_005 311 CDS 100% 6.000 4.200 N UBD n/a
8 TRCN0000007589 CGAACACATCTTCTGATGATT pLKO.1 593 3UTR 100% 5.625 3.938 N UBD n/a
9 TRCN0000007592 TGGGATTTAATGACCTTTGAT pLKO.1 80 CDS 100% 5.625 3.938 N UBD n/a
10 TRCN0000007591 CCTTACCCTGAAAGTGGTGAA pLKO.1 256 CDS 100% 4.050 2.835 N UBD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006398.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07630 pDONR223 100% 99.7% 100% None 486T>C n/a
2 ccsbBroad304_07630 pLX_304 0% 99.7% 100% V5 486T>C n/a
3 TRCN0000468997 CCGGACTTTCTTGATTTGATAGCT pLX_317 87.3% 99.7% 100% V5 486T>C n/a
Download CSV