Transcript: Human NM_006399.5

Homo sapiens basic leucine zipper ATF-like transcription factor (BATF), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
BATF (10538)
Length:
913
CDS:
215..592

Additional Resources:

NCBI RefSeq record:
NM_006399.5
NBCI Gene record:
BATF (10538)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006399.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021026 CGCGGCTCTACGCAAGGAGAT pLKO.1 409 CDS 100% 0.000 0.000 N BATF n/a
2 TRCN0000021024 CGGGAACTGTCACGACTGGAA pLKO.1 719 3UTR 100% 0.880 0.704 N BATF n/a
3 TRCN0000021025 ACTCATCTGATGATGTGAGAA pLKO.1 279 CDS 100% 4.950 3.465 N BATF n/a
4 TRCN0000235886 CTGGCAAACAGGACTCATCTG pLKO_005 267 CDS 100% 4.050 2.835 N Batf n/a
5 TRCN0000021028 GAGAAACAGAACGCGGCTCTA pLKO.1 398 CDS 100% 4.050 2.835 N BATF n/a
6 TRCN0000436076 GATGATGTGAGAAGAGTTCAG pLKO_005 287 CDS 100% 4.050 2.835 N BATF n/a
7 TRCN0000417924 AGTACTTCACGTCGGTGCTGA pLKO_005 453 CDS 100% 2.640 1.848 N BATF n/a
8 TRCN0000432174 TACGCAAGGAGATCAAGCAGC pLKO_005 417 CDS 100% 2.160 1.512 N BATF n/a
9 TRCN0000021027 CCACGCATTCCACCAACCTCA pLKO.1 544 CDS 100% 0.880 0.616 N BATF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006399.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07631 pDONR223 100% 99.7% 99.2% None 365G>C n/a
2 ccsbBroad304_07631 pLX_304 0% 99.7% 99.2% V5 365G>C n/a
3 TRCN0000470113 TTGAAAACTTTCTATAACAAAATA pLX_317 96.4% 99.7% 99.2% V5 365G>C n/a
Download CSV