Transcript: Human NM_006409.4

Homo sapiens actin related protein 2/3 complex subunit 1A (ARPC1A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
ARPC1A (10552)
Length:
1582
CDS:
137..1249

Additional Resources:

NCBI RefSeq record:
NM_006409.4
NBCI Gene record:
ARPC1A (10552)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006409.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091660 CAAGCAAGATTGTCGCAAATT pLKO.1 1144 CDS 100% 13.200 18.480 N Arpc1a n/a
2 TRCN0000331824 CAAGCAAGATTGTCGCAAATT pLKO_005 1144 CDS 100% 13.200 18.480 N Arpc1a n/a
3 TRCN0000381662 ACGGACACATCACAGGTATTG pLKO_005 291 CDS 100% 10.800 8.640 N ARPC1A n/a
4 TRCN0000005366 GCGATTTCATTCCATTCTTGA pLKO.1 1446 3UTR 100% 4.950 3.960 N ARPC1A n/a
5 TRCN0000280289 GCGATTTCATTCCATTCTTGA pLKO_005 1446 3UTR 100% 4.950 3.960 N ARPC1A n/a
6 TRCN0000005370 CCCTGGTGATCCTGAGAATTA pLKO.1 402 CDS 100% 13.200 9.240 N ARPC1A n/a
7 TRCN0000280235 CCCTGGTGATCCTGAGAATTA pLKO_005 402 CDS 100% 13.200 9.240 N ARPC1A n/a
8 TRCN0000005367 CCGCTCCTAAGTGTGTCATTT pLKO.1 878 CDS 100% 13.200 9.240 N ARPC1A n/a
9 TRCN0000280234 CCGCTCCTAAGTGTGTCATTT pLKO_005 878 CDS 100% 13.200 9.240 N ARPC1A n/a
10 TRCN0000382419 GAAGTGGAGCACGACTCATTT pLKO_005 477 CDS 100% 13.200 9.240 N ARPC1A n/a
11 TRCN0000381246 ACAAGCAAGATTGTCGCAAAT pLKO_005 1143 CDS 100% 10.800 7.560 N ARPC1A n/a
12 TRCN0000005369 CATGACAATTTGGGATTTCAA pLKO.1 1189 CDS 100% 5.625 3.938 N ARPC1A n/a
13 TRCN0000297790 CATGACAATTTGGGATTTCAA pLKO_005 1189 CDS 100% 5.625 3.938 N ARPC1A n/a
14 TRCN0000005368 GCCTACATTAAAGAAGTGGAT pLKO.1 647 CDS 100% 2.640 1.848 N ARPC1A n/a
15 TRCN0000091661 GCCTATGTCTGGAGTCAGAAA pLKO.1 362 CDS 100% 4.950 2.970 N Arpc1a n/a
16 TRCN0000302398 GCCTATGTCTGGAGTCAGAAA pLKO_005 362 CDS 100% 4.950 2.970 N Arpc1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006409.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02466 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02466 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471087 GTATTTTATGACAACCATGGTGTA pLX_317 40% 100% 100% V5 n/a
Download CSV