Transcript: Human NM_006433.5

Homo sapiens granulysin (GNLY), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
GNLY (10578)
Length:
777
CDS:
62..499

Additional Resources:

NCBI RefSeq record:
NM_006433.5
NBCI Gene record:
GNLY (10578)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006433.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372368 CGCGACGTCTGCAGAAATTTC pLKO_005 371 CDS 100% 13.200 18.480 N GNLY n/a
2 TRCN0000008015 CCTGTCTGACGATAGTCCAAA pLKO.1 264 CDS 100% 4.950 6.930 N GNLY n/a
3 TRCN0000008013 GAGGACCTCAGGTTGTGTATA pLKO.1 458 CDS 100% 13.200 9.240 N GNLY n/a
4 TRCN0000008012 ACTGAAGAAGATGGTGGATAA pLKO.1 286 CDS 100% 10.800 7.560 N GNLY n/a
5 TRCN0000378776 ACCCAGAGAAGTGTTTCCAAT pLKO_005 311 CDS 100% 4.950 3.465 N GNLY n/a
6 TRCN0000008014 AGGAGGTATCAGTCTAGAGTT pLKO.1 395 CDS 100% 4.950 3.465 N GNLY n/a
7 TRCN0000372415 TCGTCTGAGCCCTGAGTACTA pLKO_005 127 CDS 100% 4.950 3.465 N GNLY n/a
8 TRCN0000008011 CCTCTCACCTTGTCCTGTGGA pLKO.1 502 3UTR 100% 0.880 0.616 N GNLY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006433.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02476 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02476 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481620 AGCAGTGCTCCTAATACATTCGGG pLX_317 77.3% 100% 100% V5 n/a
Download CSV