Transcript: Human NM_006520.3

Homo sapiens dynein light chain Tctex-type 3 (DYNLT3), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
DYNLT3 (6990)
Length:
2151
CDS:
62..412

Additional Resources:

NCBI RefSeq record:
NM_006520.3
NBCI Gene record:
DYNLT3 (6990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006520.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303558 TCTATACAGCATCGTTTAAAT pLKO_005 596 3UTR 100% 15.000 21.000 N DYNLT3 n/a
2 TRCN0000116361 GAACCGGACCATGAACTGTAT pLKO.1 358 CDS 100% 4.950 6.930 N DYNLT3 n/a
3 TRCN0000116358 GCATAGTGGAACAATCCTTAA pLKO.1 198 CDS 100% 10.800 8.640 N DYNLT3 n/a
4 TRCN0000315716 GCATAGTGGAACAATCCTTAA pLKO_005 198 CDS 100% 10.800 8.640 N DYNLT3 n/a
5 TRCN0000303488 GTGGTCCAGAAGAGCGCATAT pLKO_005 269 CDS 100% 10.800 8.640 N DYNLT3 n/a
6 TRCN0000116357 GCGAAGTCAATCTGCTACTTA pLKO.1 1667 3UTR 100% 5.625 4.500 N DYNLT3 n/a
7 TRCN0000303490 TAGGTGGTGAAGATTATAATC pLKO_005 150 CDS 100% 13.200 9.240 N DYNLT3 n/a
8 TRCN0000116359 CTGTACCGTAAGATGGGAGAA pLKO.1 340 CDS 100% 4.050 2.835 N DYNLT3 n/a
9 TRCN0000315726 CTGTACCGTAAGATGGGAGAA pLKO_005 340 CDS 100% 4.050 2.835 N DYNLT3 n/a
10 TRCN0000116360 GCTGAGGAAGCCCACAATATT pLKO.1 104 CDS 100% 15.000 9.000 N DYNLT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006520.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01655 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01655 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478514 TACGGTATAATCTTCTACTAGTGT pLX_317 97% 100% 100% V5 n/a
Download CSV