Transcript: Human NM_006566.4

Homo sapiens CD226 molecule (CD226), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CD226 (10666)
Length:
12123
CDS:
73..1083

Additional Resources:

NCBI RefSeq record:
NM_006566.4
NBCI Gene record:
CD226 (10666)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006566.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416820 GTACTCATGCATGGATCTTTA pLKO_005 1123 3UTR 100% 13.200 18.480 N CD226 n/a
2 TRCN0000057636 CGCAGACCAAAGACTAGAGTT pLKO.1 1060 CDS 100% 4.950 3.960 N CD226 n/a
3 TRCN0000434449 ATGATACAAGAGAGGATATTT pLKO_005 1016 CDS 100% 15.000 10.500 N CD226 n/a
4 TRCN0000421790 GCTTTGGGCAAGGGCTATTTA pLKO_005 1336 3UTR 100% 15.000 10.500 N CD226 n/a
5 TRCN0000421963 ATCCATCAATGGGCATCTTAA pLKO_005 188 CDS 100% 13.200 9.240 N CD226 n/a
6 TRCN0000057637 GCCGAGAACATGTCTCTAGAA pLKO.1 160 CDS 100% 4.950 3.465 N CD226 n/a
7 TRCN0000057633 GCTTCCAATAACATGACTCTT pLKO.1 331 CDS 100% 4.950 3.465 N CD226 n/a
8 TRCN0000057635 CCCAAGACAAATAGTGAGCAA pLKO.1 645 CDS 100% 2.640 1.848 N CD226 n/a
9 TRCN0000139826 CCTCCTGAATAGCTGGGATTA pLKO.1 5427 3UTR 100% 10.800 5.400 Y SYNPO2 n/a
10 TRCN0000107105 CGAGGTCAGGAGTTTGAGATT pLKO.1 6434 3UTR 100% 4.950 2.475 Y NLRP12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006566.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07666 pDONR223 100% 99.9% 99.7% None 919A>G n/a
2 ccsbBroad304_07666 pLX_304 0% 99.9% 99.7% V5 919A>G n/a
3 TRCN0000480825 TGTTGGCTCTCGCACATGCACCCA pLX_317 33.2% 99.9% 99.7% V5 919A>G n/a
Download CSV