Transcript: Human NM_006569.6

Homo sapiens cell growth regulator with EF-hand domain 1 (CGREF1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CGREF1 (10669)
Length:
1931
CDS:
295..1251

Additional Resources:

NCBI RefSeq record:
NM_006569.6
NBCI Gene record:
CGREF1 (10669)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006569.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371735 CTCAGGGAGACCCTAAGTTAA pLKO_005 1392 3UTR 100% 13.200 10.560 N CGREF1 n/a
2 TRCN0000371781 GTTGGAAGGCAGTCCCTATTA pLKO_005 790 CDS 100% 13.200 9.240 N CGREF1 n/a
3 TRCN0000371782 TGATCTTGATAGTGGACAAAG pLKO_005 638 CDS 100% 10.800 7.560 N CGREF1 n/a
4 TRCN0000053598 GCTACCTAAAGGGACTAGGAA pLKO.1 452 CDS 100% 3.000 2.100 N CGREF1 n/a
5 TRCN0000053602 CCAGACTCTGAAGTGCAGCAT pLKO.1 376 CDS 100% 2.640 1.848 N CGREF1 n/a
6 TRCN0000053601 CTGGAGTCTAAGAACACCCAA pLKO.1 1183 CDS 100% 2.640 1.848 N CGREF1 n/a
7 TRCN0000053599 GCACATTGTTCAAGTGGAGAA pLKO.1 1218 CDS 100% 4.050 2.430 N CGREF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006569.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11536 pDONR223 100% 94.4% 94.6% None 348C>A;375C>G;709_759del n/a
2 ccsbBroad304_11536 pLX_304 0% 94.4% 94.6% V5 348C>A;375C>G;709_759del n/a
Download CSV