Transcript: Human NM_006590.4

Homo sapiens ubiquitin specific peptidase 39 (USP39), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
USP39 (10713)
Length:
2183
CDS:
11..1708

Additional Resources:

NCBI RefSeq record:
NM_006590.4
NBCI Gene record:
USP39 (10713)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006590.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001151 CCTTCCAGACAACTATGAGAT pLKO.1 532 CDS 100% 4.950 6.930 N USP39 n/a
2 TRCN0000272712 CCTTCCAGACAACTATGAGAT pLKO_005 532 CDS 100% 4.950 6.930 N USP39 n/a
3 TRCN0000001154 GCCGGGTATTGTGGGACTGAA pLKO.1 673 CDS 100% 1.650 2.310 N USP39 n/a
4 TRCN0000272711 CCCGTACCTGGACACCATTAA pLKO_005 325 CDS 100% 13.200 9.240 N USP39 n/a
5 TRCN0000001150 GATTTGGAAGAGGCGAGATAA pLKO.1 1660 CDS 100% 13.200 9.240 N USP39 n/a
6 TRCN0000284817 GATTTGGAAGAGGCGAGATAA pLKO_005 1660 CDS 100% 13.200 9.240 N USP39 n/a
7 TRCN0000001153 GTTGCCTCCATATCTAATCTT pLKO.1 1345 CDS 100% 5.625 3.938 N USP39 n/a
8 TRCN0000284816 GTTGCCTCCATATCTAATCTT pLKO_005 1345 CDS 100% 5.625 3.938 N USP39 n/a
9 TRCN0000001152 CTGAATAACATAAAGGCCAAT pLKO.1 689 CDS 100% 4.050 2.835 N USP39 n/a
10 TRCN0000272660 TGTGGCTGATGATGGTAAATA pLKO_005 1740 3UTR 100% 15.000 9.000 N USP39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006590.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02512 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02512 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472272 TGTCTCGCAGCTACAGTGGCTTAG pLX_317 26.4% 100% 100% V5 n/a
Download CSV