Construct: ORF TRCN0000472272
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015242.1_s317c1
- Derived from:
- ccsbBroadEn_02512
- DNA Barcode:
- TGTCTCGCAGCTACAGTGGCTTAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- USP39 (10713)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472272
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10713 | USP39 | ubiquitin specific peptidas... | NM_001256725.2 | 100% | 100% | |
| 2 | human | 10713 | USP39 | ubiquitin specific peptidas... | NM_006590.4 | 100% | 100% | |
| 3 | human | 10713 | USP39 | ubiquitin specific peptidas... | NM_001256726.2 | 86.3% | 84.2% | 1427_1428ins136;1464_1465ins95 |
| 4 | human | 10713 | USP39 | ubiquitin specific peptidas... | NM_001256727.1 | 84.3% | 84.4% | (many diffs) |
| 5 | human | 10713 | USP39 | ubiquitin specific peptidas... | NM_001256728.1 | 79.8% | 79.1% | (many diffs) |
| 6 | human | 10713 | USP39 | ubiquitin specific peptidas... | XR_939653.2 | 78.5% | 1_61del;1625_1710del;1843_2157del | |
| 7 | human | 10713 | USP39 | ubiquitin specific peptidas... | XR_939652.2 | 73% | 1_61del;1625_1710del;1843_2320del | |
| 8 | human | 10713 | USP39 | ubiquitin specific peptidas... | NR_046347.2 | 70% | (many diffs) | |
| 9 | human | 10713 | USP39 | ubiquitin specific peptidas... | XR_001738593.1 | 65.4% | (many diffs) | |
| 10 | human | 10713 | USP39 | ubiquitin specific peptidas... | XM_006711922.2 | 52.3% | 52.3% | 0_1ins807 |
| 11 | human | 10713 | USP39 | ubiquitin specific peptidas... | XM_006711923.2 | 52.3% | 52.3% | 0_1ins807 |
| 12 | human | 10713 | USP39 | ubiquitin specific peptidas... | XM_011532487.1 | 52.3% | 52.3% | 0_1ins807 |
| 13 | human | 10713 | USP39 | ubiquitin specific peptidas... | XM_011532488.1 | 52.3% | 52.3% | 0_1ins807 |
| 14 | human | 10713 | USP39 | ubiquitin specific peptidas... | XM_017003182.1 | 52.3% | 52.3% | 0_1ins807 |
| 15 | mouse | 28035 | Usp39 | ubiquitin specific peptidas... | NM_138592.4 | 89.7% | 97.3% | (many diffs) |
| 16 | mouse | 28035 | Usp39 | ubiquitin specific peptidas... | XM_006506216.3 | 86.8% | 93.2% | (many diffs) |
| 17 | mouse | 28035 | Usp39 | ubiquitin specific peptidas... | XM_017321609.1 | 47.6% | 52.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1761
- ORF length:
- 1695
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc cggccggtct aagcgggagt ctcgcggttc cactcgcggg aagcgagagt 121 ctgagtcgcg gggcagctcc ggtcgcgtca agcgggagcg agatcgggag cgggagcctg 181 aggcggcgag ctcccggggc agccctgtgc gcgtgaagcg ggagttcgag ccggcgagcg 241 cgcgcgaggc cccggcttct gttgtcccgt ttgtgcgggt gaagcgggag cgcgaggtcg 301 atgaggactc ggagcctgag cgggaggtgc gagcaaagaa tggccgagtg gattctgagg 361 accggaggag ccgccactgc ccgtacctgg acaccattaa caggagtgtg ctggactttg 421 actttgagaa actgtgttct atctccctct cacacatcaa tgcttatgcc tgtctggtgt 481 gtggcaagta ctttcaaggc cggggtttga agtctcacgc ctacattcac agtgtccagt 541 ttagccacca tgttttcctc aacctccaca ccctcaagtt ttactgcctt ccagacaact 601 atgagatcat cgattcctca ttggaggata tcacgtatgt gttgaagccc actttcacaa 661 agcagcaaat tgcaaacttg gacaagcaag ccaaattgtc ccgggcatat gatggtacca 721 cttacctgcc gggtattgtg ggactgaata acataaaggc caatgattat gccaacgctg 781 tccttcaggc tctatctaat gttcctcctc tccggaacta ctttctggaa gaagacaatt 841 ataagaacat caaacgtcct ccaggggata tcatgttctt gttggtccag cgttttggag 901 agctgatgag aaagctctgg aaccctcgaa atttcaaggc acatgtgtct ccccatgaga 961 tgcttcaggc agttgtactt tgcagtaaga agacttttca gatcaccaaa caaggagatg 1021 gcgttgactt tctgtcttgg tttctgaatg ctctgcactc agctctgggg ggcacaaaga 1081 agaaaaagaa gactattgtg actgatgttt tccaggggtc catgaggatc ttcactaaaa 1141 agcttcccca tcctgatctg ccagcagaag aaaaagagca gttgctccat aatgacgagt 1201 accaggagac aatggtggag tccactttta tgtacctgac gctggacctt cctactgccc 1261 ccctctacaa ggacgagaag gagcagctca tcattcccca agtgccactc ttcaacaTCC 1321 TGGCTAAGTT CAATGGCATC ACTGAGAAGG AATATAAGAC TTACAAGGAG AACTTTCTGA 1381 AGCGCTTCCA GCTTACCAAG TTGCCTCCAT ATCTAATCTT TTGTATCAAG AGATTCACTA 1441 AGAACAACTT CTTTGTTGAG AAGAATCCAA CTATTGTCAA TTTCCCTATT ACAAATGTGG 1501 ATCTGAGAGA ATACTTGTCT GAAGAAGTAC AAGCAGTACA CAAGAATACC ACCTATGACC 1561 TCATTGCCAA CATCGTGCAT GACGGCAAGC CCTCCGAGGG CTCCTACCGG ATCCACGTGC 1621 TTCATCATGG GACAGGCAAA TGGTATGAAT TACAAGACCT CCAGGTGACT GACATCCTTC 1681 CCCAGATGAT CACACTGTCA GAGGCTTACA TTCAGATTTG GAAGAGGCGA GATAATGATG 1741 AAACCAACCA GCAGGGGGCT TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1801 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1861 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATGTC TCGCAGCTAC 1921 AGTGGCTTAG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt