Transcript: Human NM_006627.3

Homo sapiens POP4 homolog, ribonuclease P/MRP subunit (POP4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
POP4 (10775)
Length:
2556
CDS:
37..699

Additional Resources:

NCBI RefSeq record:
NM_006627.3
NBCI Gene record:
POP4 (10775)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006627.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049882 CTGCGGCTCTTTGACATTAAA pLKO.1 286 CDS 100% 15.000 21.000 N POP4 n/a
2 TRCN0000049878 CCTACATTTACGGGAGCAAAT pLKO.1 614 CDS 100% 10.800 15.120 N POP4 n/a
3 TRCN0000293579 GGTCTGCGAAGAAGTTCAAAG pLKO_005 656 CDS 100% 10.800 8.640 N POP4 n/a
4 TRCN0000049880 CGATGGCTTTATTTCCTACAT pLKO.1 600 CDS 100% 4.950 3.960 N POP4 n/a
5 TRCN0000293636 GTTGACTTGAATAGGATTATT pLKO_005 979 3UTR 100% 15.000 10.500 N POP4 n/a
6 TRCN0000049881 CCCTCTTATGTGGGTATTACA pLKO.1 478 CDS 100% 5.625 3.938 N POP4 n/a
7 TRCN0000318879 CCCTCTTATGTGGGTATTACA pLKO_005 478 CDS 100% 5.625 3.938 N POP4 n/a
8 TRCN0000098857 CCATGAACTCTGGAAACAGTA pLKO.1 342 CDS 100% 4.950 3.465 N Pop4 n/a
9 TRCN0000287348 CCATGAACTCTGGAAACAGTA pLKO_005 342 CDS 100% 4.950 3.465 N Pop4 n/a
10 TRCN0000293577 TCTCAGAAAGAGGCGAATGAC pLKO_005 64 CDS 100% 4.950 3.465 N POP4 n/a
11 TRCN0000293580 CACCAAAGAAGACCGCCTGAA pLKO_005 540 CDS 100% 4.050 2.835 N POP4 n/a
12 TRCN0000049879 CCTCTCCATGAACTCTGGAAA pLKO.1 337 CDS 100% 4.950 2.970 N POP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006627.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02526 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02526 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473775 TGAAGTCGCCGACTGTATTATACC pLX_317 56% 100% 100% V5 n/a
4 ccsbBroadEn_07677 pDONR223 100% 99.8% 100% None 651G>A n/a
5 ccsbBroad304_07677 pLX_304 0% 99.8% 100% V5 651G>A n/a
6 TRCN0000470867 TTAACTTGGCAACATAACATTATC pLX_317 54.8% 99.8% 100% V5 651G>A n/a
Download CSV