Transcript: Human NM_006628.6

Homo sapiens cAMP regulated phosphoprotein 19 (ARPP19), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ARPP19 (10776)
Length:
5366
CDS:
139..477

Additional Resources:

NCBI RefSeq record:
NM_006628.6
NBCI Gene record:
ARPP19 (10776)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006628.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158554 CCTCTCACAAATGTCTGTATT pLKO.1 1219 3UTR 100% 13.200 18.480 N ARPP19 n/a
2 TRCN0000159223 CAGAAGGAAATGGAAGATAAA pLKO.1 178 CDS 100% 13.200 9.240 N ARPP19 n/a
3 TRCN0000160408 CTGGAGGTTCAGATTTCTTAA pLKO.1 266 CDS 100% 13.200 9.240 N ARPP19 n/a
4 TRCN0000344298 CTGGAGGTTCAGATTTCTTAA pLKO_005 266 CDS 100% 13.200 9.240 N ARPP19 n/a
5 TRCN0000159778 GCCACAATTTAGGACACATTT pLKO.1 4589 3UTR 100% 13.200 9.240 N ARPP19 n/a
6 TRCN0000161386 GCCTCAAACATAGCACCTTAA pLKO.1 2396 3UTR 100% 10.800 7.560 N ARPP19 n/a
7 TRCN0000161908 GATATCCTCATCTGGGACAAA pLKO.1 242 CDS 100% 4.950 3.465 N ARPP19 n/a
8 TRCN0000344219 GATATCCTCATCTGGGACAAA pLKO_005 242 CDS 100% 4.950 3.465 N ARPP19 n/a
9 TRCN0000159192 GCTCAGTTTATTGAAGACATT pLKO.1 3066 3UTR 100% 4.950 3.465 N ARPP19 n/a
10 TRCN0000162506 CTTAAGGAAACGGTTGCAGAA pLKO.1 282 CDS 100% 4.050 2.835 N ARPP19 n/a
11 TRCN0000344299 CTTAAGGAAACGGTTGCAGAA pLKO_005 282 CDS 100% 4.050 2.835 N ARPP19 n/a
12 TRCN0000159670 GATTACAACATGGCTAAAGCA pLKO.1 328 CDS 100% 3.000 2.100 N ARPP19 n/a
13 TRCN0000344300 GATTACAACATGGCTAAAGCA pLKO_005 328 CDS 100% 3.000 2.100 N ARPP19 n/a
14 TRCN0000159191 GAAATGGAAGATAAAGTGACT pLKO.1 184 CDS 100% 2.640 1.848 N ARPP19 n/a
15 TRCN0000158847 GCAGAAGGAAATGGAAGATAA pLKO.1 177 CDS 100% 13.200 7.920 N ARPP19 n/a
16 TRCN0000344296 GCAGAAGGAAATGGAAGATAA pLKO_005 177 CDS 100% 13.200 7.920 N ARPP19 n/a
17 TRCN0000163513 GAGGAGCAGAAGGAAATGGAA pLKO.1 172 CDS 100% 3.000 1.800 N ARPP19 n/a
18 TRCN0000250795 CAAGCTGGCTGGCTGATTAAA pLKO_005 462 CDS 100% 15.000 10.500 N Arpp19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006628.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14055 pDONR223 100% 99.7% 99.1% None 336_337insC n/a
2 ccsbBroad304_14055 pLX_304 0% 99.7% 99.1% V5 (not translated due to frame shift) 336_337insC n/a
3 TRCN0000475757 ATTATTGTCCTGCGTTTGCATAGG pLX_317 65.2% 99.7% 99.1% V5 (not translated due to prior stop codon) 336_337insC n/a
Download CSV