Transcript: Human NM_006643.4

Homo sapiens endosome associated trafficking regulator 1 (ENTR1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ENTR1 (10807)
Length:
2322
CDS:
218..1456

Additional Resources:

NCBI RefSeq record:
NM_006643.4
NBCI Gene record:
ENTR1 (10807)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006643.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142008 GATGACCAAACGGGCTGTAAA pLKO.1 1147 CDS 100% 13.200 18.480 N ENTR1 n/a
2 TRCN0000249210 GATGACCAAACGGGCTGTAAA pLKO_005 1147 CDS 100% 13.200 18.480 N Sdccag3 n/a
3 TRCN0000121877 GCCGAAATCCTTAAATCTATA pLKO.1 1394 CDS 100% 13.200 18.480 N ENTR1 n/a
4 TRCN0000281327 GCCGAAATCCTTAAATCTATA pLKO_005 1394 CDS 100% 13.200 18.480 N ENTR1 n/a
5 TRCN0000281330 GCGAAATTCCTGCGATCTTAT pLKO_005 1674 3UTR 100% 13.200 18.480 N ENTR1 n/a
6 TRCN0000142560 GCAGTCTTCACCCAGAGTAAA pLKO.1 1546 3UTR 100% 13.200 10.560 N ENTR1 n/a
7 TRCN0000122327 CGGCCAGCAGAATTTATGCAA pLKO.1 528 CDS 100% 3.000 2.400 N ENTR1 n/a
8 TRCN0000281328 CGGCCAGCAGAATTTATGCAA pLKO_005 528 CDS 100% 3.000 2.400 N ENTR1 n/a
9 TRCN0000122745 CTGGAGTATCAGCAGCCATTT pLKO.1 617 CDS 100% 10.800 7.560 N ENTR1 n/a
10 TRCN0000141768 GCGTTGAGTGACACTGATTCT pLKO.1 839 CDS 100% 4.950 3.465 N ENTR1 n/a
11 TRCN0000297945 GCGTTGAGTGACACTGATTCT pLKO_005 839 CDS 100% 4.950 3.465 N ENTR1 n/a
12 TRCN0000142559 GCTTCCATCAAGCAACTGGTT pLKO.1 1346 CDS 100% 2.640 1.848 N ENTR1 n/a
13 TRCN0000142327 CAGAGCTTCTCTGAAGCTCAA pLKO.1 1013 CDS 100% 0.405 0.284 N ENTR1 n/a
14 TRCN0000143573 GAAGATCTGGAAGAGGCAAAT pLKO.1 449 CDS 100% 10.800 6.480 N ENTR1 n/a
15 TRCN0000281329 GAAGATCTGGAAGAGGCAAAT pLKO_005 449 CDS 100% 10.800 6.480 N ENTR1 n/a
16 TRCN0000249209 CGGACGCTGCAGATAAGTTAT pLKO_005 941 CDS 100% 13.200 9.240 N Sdccag3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006643.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11554 pDONR223 100% 85.6% 85.4% None (many diffs) n/a
2 ccsbBroad304_11554 pLX_304 0% 85.6% 85.4% V5 (many diffs) n/a
3 TRCN0000473198 TATGGCGAGCGGGCTATAATTAGA pLX_317 32.9% 85.6% 85.4% V5 (many diffs) n/a
Download CSV