Transcript: Human NM_006651.4

Homo sapiens complexin 1 (CPLX1), mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
CPLX1 (10815)
Length:
2112
CDS:
164..568

Additional Resources:

NCBI RefSeq record:
NM_006651.4
NBCI Gene record:
CPLX1 (10815)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006651.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183408 CCGTGTTCACTTCTAAACTAA pLKO.1 1164 3UTR 100% 5.625 7.875 N CPLX1 n/a
2 TRCN0000179647 GCCGTGTTCACTTCTAAACTA pLKO.1 1163 3UTR 100% 5.625 7.875 N CPLX1 n/a
3 TRCN0000146755 CCATAACGTTAGACTGCAATA pLKO.1 1729 3UTR 100% 10.800 7.560 N CPLX1 n/a
4 TRCN0000179857 CAAGTACGGCATCAAGAAGAA pLKO.1 367 CDS 100% 4.950 3.465 N CPLX1 n/a
5 TRCN0000436946 CCGAGACAAGTACGGCATCAA pLKO_005 361 CDS 100% 4.950 3.465 N CPLX1 n/a
6 TRCN0000180543 GAGACAAGTACGGCATCAAGA pLKO.1 363 CDS 100% 4.950 3.465 N CPLX1 n/a
7 TRCN0000146968 CATAGCTTTAGAGAAGCCATA pLKO.1 1713 3UTR 100% 4.050 2.835 N CPLX1 n/a
8 TRCN0000180669 GCAGGACATGCTCAAGAAGTA pLKO.1 547 CDS 100% 4.950 2.970 N CPLX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006651.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02536 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02536 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467107 GTTATGTTGGCCATTTATTACTCA pLX_317 46.9% 100% 100% V5 n/a
Download CSV