Transcript: Human NM_006653.5

Homo sapiens fibroblast growth factor receptor substrate 3 (FRS3), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
FRS3 (10817)
Length:
2174
CDS:
253..1731

Additional Resources:

NCBI RefSeq record:
NM_006653.5
NBCI Gene record:
FRS3 (10817)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006653.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061681 ACCAAGTTCAAGGTGACAAAT pLKO.1 307 CDS 100% 13.200 9.240 N FRS3 n/a
2 TRCN0000414737 GGGTTCCTGTGATTGCGTTTA pLKO_005 1978 3UTR 100% 10.800 7.560 N FRS3 n/a
3 TRCN0000426932 TGCAGTGCAACAGCATCAATG pLKO_005 566 CDS 100% 10.800 7.560 N FRS3 n/a
4 TRCN0000061680 CCAAGGGTCTTCAACTTTGAT pLKO.1 1441 CDS 100% 5.625 3.938 N FRS3 n/a
5 TRCN0000061678 CCACACCACAATAATAACAAT pLKO.1 1051 CDS 100% 5.625 3.938 N FRS3 n/a
6 TRCN0000061679 CCTGTCATCATCACCCGCAAT pLKO.1 598 CDS 100% 4.050 2.835 N FRS3 n/a
7 TRCN0000061682 GCTTAACTACATCCAGGTGGA pLKO.1 1494 CDS 100% 2.160 1.512 N FRS3 n/a
8 TRCN0000416854 AGATATCAGCCACCGAGTCTC pLKO_005 1888 3UTR 100% 4.050 2.430 N FRS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006653.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07686 pDONR223 100% 99.7% 99.5% None 8_9delGCinsTT;1459A>T n/a
2 ccsbBroad304_07686 pLX_304 0% 99.7% 99.5% V5 8_9delGCinsTT;1459A>T n/a
3 TRCN0000467161 CTCAACGGAAAATATCTGAGTTTC pLX_317 29.2% 99.7% 99.5% V5 8_9delGCinsTT;1459A>T n/a
Download CSV