Transcript: Human NM_006662.3

Homo sapiens Snf2 related CREBBP activator protein (SRCAP), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SRCAP (10847)
Length:
11724
CDS:
356..10048

Additional Resources:

NCBI RefSeq record:
NM_006662.3
NBCI Gene record:
SRCAP (10847)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006662.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021354 CGGATAGACATGGGTCGATTT pLKO.1 3173 CDS 100% 10.800 15.120 N SRCAP n/a
2 TRCN0000021358 GCCTTGATGGAACGGTTCAAT pLKO.1 6653 CDS 100% 5.625 7.875 N SRCAP n/a
3 TRCN0000281129 GCCTTGATGGAACGGTTCAAT pLKO_005 6653 CDS 100% 5.625 7.875 N SRCAP n/a
4 TRCN0000021357 CCCTCAGGTGTTGGAGATAAA pLKO.1 1474 CDS 100% 13.200 9.240 N SRCAP n/a
5 TRCN0000281131 CCCTCAGGTGTTGGAGATAAA pLKO_005 1474 CDS 100% 13.200 9.240 N SRCAP n/a
6 TRCN0000297941 GACCAGGCCTGACTCTGTTAA pLKO_005 10097 3UTR 100% 13.200 9.240 N SRCAP n/a
7 TRCN0000021356 GCCAGCAAGCAGACTCATATT pLKO.1 7055 CDS 100% 13.200 9.240 N SRCAP n/a
8 TRCN0000281130 GCCAGCAAGCAGACTCATATT pLKO_005 7055 CDS 100% 13.200 9.240 N SRCAP n/a
9 TRCN0000021355 CCAGTATGATTGCGGAAAGTT pLKO.1 6469 CDS 100% 5.625 3.938 N SRCAP n/a
10 TRCN0000281199 CCAGTATGATTGCGGAAAGTT pLKO_005 6469 CDS 100% 5.625 3.938 N SRCAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006662.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.