Transcript: Human NM_006678.5

Homo sapiens CD300c molecule (CD300C), mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
CD300C (10871)
Length:
1524
CDS:
334..1008

Additional Resources:

NCBI RefSeq record:
NM_006678.5
NBCI Gene record:
CD300C (10871)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006678.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444492 AGCTGTGAGTCCACGTCTCAT pLKO_005 1197 3UTR 100% 4.950 6.930 N CD300C n/a
2 TRCN0000416414 TAGCATCTGCTGTCCATCAAG pLKO_005 1006 CDS 100% 4.950 3.465 N CD300C n/a
3 TRCN0000062978 CCTGTTCAGCAATGTCCGCTT pLKO.1 864 CDS 100% 2.160 1.512 N CD300C n/a
4 TRCN0000062980 AGGCAGAATTGGCCCAAGGGT pLKO.1 976 CDS 100% 0.250 0.175 N CD300C n/a
5 TRCN0000062982 GCACCTCAGGTCCTCCCACGA pLKO.1 773 CDS 100% 0.000 0.000 N CD300C n/a
6 TRCN0000062979 CGAGACTTTCATGATCCCATT pLKO.1 685 CDS 100% 4.050 2.430 N CD300C n/a
7 TRCN0000062981 GACAAGATTGTGGAGACCAAA pLKO.1 529 CDS 100% 4.950 2.475 Y CD300C n/a
8 TRCN0000163279 GAGAATCTCACAGAGGAGGAT pLKO.1 625 CDS 100% 2.640 1.320 Y CD300A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006678.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02542 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02542 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472592 TTGACTTTGATGTATCAGATCTAC pLX_317 44.9% 100% 100% V5 n/a
Download CSV