Transcript: Human NM_006782.4

Homo sapiens zinc finger protein like 1 (ZFPL1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ZFPL1 (7542)
Length:
1382
CDS:
166..1098

Additional Resources:

NCBI RefSeq record:
NM_006782.4
NBCI Gene record:
ZFPL1 (7542)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006782.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033709 GCTCCAAGATAGCGACTACAA pLKO.1 294 CDS 100% 4.950 6.930 N ZFPL1 n/a
2 TRCN0000291783 GCTCCAAGATAGCGACTACAA pLKO_005 294 CDS 100% 4.950 6.930 N ZFPL1 n/a
3 TRCN0000033710 GTGTATGATACGCGGGATGAT pLKO.1 805 CDS 100% 4.950 6.930 N ZFPL1 n/a
4 TRCN0000291854 GTGTATGATACGCGGGATGAT pLKO_005 805 CDS 100% 4.950 6.930 N ZFPL1 n/a
5 TRCN0000033713 CCCACTCATGAACCCTCACAT pLKO.1 1059 CDS 100% 4.950 3.465 N ZFPL1 n/a
6 TRCN0000291856 CCCACTCATGAACCCTCACAT pLKO_005 1059 CDS 100% 4.950 3.465 N ZFPL1 n/a
7 TRCN0000033712 CCTTGTCTGCTATGATCTCTT pLKO.1 366 CDS 100% 4.950 3.465 N ZFPL1 n/a
8 TRCN0000291858 CCTTGTCTGCTATGATCTCTT pLKO_005 366 CDS 100% 4.950 3.465 N ZFPL1 n/a
9 TRCN0000033711 CTGACTTCTCTGACTGGTCTA pLKO.1 617 CDS 100% 4.050 2.835 N ZFPL1 n/a
10 TRCN0000291784 CTGACTTCTCTGACTGGTCTA pLKO_005 617 CDS 100% 4.050 2.835 N ZFPL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006782.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01790 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01790 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475753 TGGAAATCGTACGTAAATCCCGTG pLX_317 34.7% 100% 100% V5 n/a
Download CSV