Transcript: Human NM_006805.4

Homo sapiens heterogeneous nuclear ribonucleoprotein A0 (HNRNPA0), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
HNRNPA0 (10949)
Length:
8713
CDS:
298..1215

Additional Resources:

NCBI RefSeq record:
NM_006805.4
NBCI Gene record:
HNRNPA0 (10949)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006805.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221606 CGGCTTCGTGTATTTCCAGAA pLKO.1 720 CDS 100% 4.050 5.670 N HNRNPA0 n/a
2 TRCN0000349657 CGGCTTCGTGTATTTCCAGAA pLKO_005 720 CDS 100% 4.050 5.670 N HNRNPA0 n/a
3 TRCN0000221607 GTCGCAGTAATAGTGGACCTT pLKO.1 1145 CDS 100% 2.640 3.696 N HNRNPA0 n/a
4 TRCN0000221609 CCCGTTGCTTTGGCTTCGTGA pLKO.1 437 CDS 100% 0.880 1.232 N HNRNPA0 n/a
5 TRCN0000349589 CCCGTTGCTTTGGCTTCGTGA pLKO_005 437 CDS 100% 0.880 1.232 N HNRNPA0 n/a
6 TRCN0000017236 CGACAAGCAGTCCGGCAAGAA pLKO.1 690 CDS 100% 1.650 1.155 N HNRNPA0 n/a
7 TRCN0000318905 CGACAAGCAGTCCGGCAAGAA pLKO_005 690 CDS 100% 1.650 1.155 N HNRNPA0 n/a
8 TRCN0000221608 GCCAAGGTTAAGAAGCTCTTT pLKO.1 580 CDS 100% 4.950 2.970 N HNRNPA0 n/a
9 TRCN0000318971 GCCAAGGTTAAGAAGCTCTTT pLKO_005 580 CDS 100% 4.950 2.970 N HNRNPA0 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006805.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14980 pDONR223 65.4% 99% 98.6% None 559G>A;565_566delCGinsTT;894_899delTGGCTA n/a
2 ccsbBroad304_14980 pLX_304 0% 99% 98.6% V5 559G>A;565_566delCGinsTT;894_899delTGGCTA n/a
3 TRCN0000468258 GCTAACATTCCGTACCTTGTTAGC pLX_317 70.8% 61.7% 61.3% V5 559G>A;565_567delCGAinsT;570_915del n/a
Download CSV