Transcript: Human NM_006828.4

Homo sapiens activating signal cointegrator 1 complex subunit 3 (ASCC3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
ASCC3 (10973)
Length:
8111
CDS:
311..6919

Additional Resources:

NCBI RefSeq record:
NM_006828.4
NBCI Gene record:
ASCC3 (10973)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006828.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296024 CTACTTCAAAGGCGGTATATA pLKO_005 4422 CDS 100% 15.000 21.000 N ASCC3 n/a
2 TRCN0000296022 CATCTAGACAAATCGAATTAC pLKO_005 6974 3UTR 100% 13.200 18.480 N ASCC3 n/a
3 TRCN0000341736 GAATTGCCTCCTATTACTATT pLKO_005 5760 CDS 100% 13.200 18.480 N Ascc3 n/a
4 TRCN0000052186 GCAGCTTGTAATGCTACTAAT pLKO.1 695 CDS 100% 13.200 18.480 N ASCC3 n/a
5 TRCN0000052187 CCCAGTAGAATCAAGTTTATT pLKO.1 5473 CDS 100% 15.000 10.500 N ASCC3 n/a
6 TRCN0000296023 TGAGGAGCGAACTGGATATTT pLKO_005 3217 CDS 100% 15.000 10.500 N ASCC3 n/a
7 TRCN0000296021 AGCATAGTTGCCCGTACTTTA pLKO_005 2186 CDS 100% 13.200 9.240 N ASCC3 n/a
8 TRCN0000052185 CCCAGATTGTAAGGCTCCTTA pLKO.1 2115 CDS 100% 4.950 3.465 N ASCC3 n/a
9 TRCN0000288730 CCCAGATTGTAAGGCTCCTTA pLKO_005 2115 CDS 100% 4.950 3.465 N ASCC3 n/a
10 TRCN0000052184 CCAGTGATAAATGTTGGCATA pLKO.1 6410 CDS 100% 4.050 2.835 N ASCC3 n/a
11 TRCN0000052183 CGCATGATAAACTCAGCCATT pLKO.1 2916 CDS 100% 4.050 2.835 N ASCC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006828.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02581 pDONR223 100% 4.6% 3.9% None (many diffs) n/a
2 ccsbBroad304_02581 pLX_304 0% 4.6% 3.9% V5 (many diffs) n/a
Download CSV