Transcript: Human NM_006833.5

Homo sapiens COP9 signalosome subunit 6 (COPS6), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
COPS6 (10980)
Length:
1404
CDS:
23..1006

Additional Resources:

NCBI RefSeq record:
NM_006833.5
NBCI Gene record:
COPS6 (10980)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006833.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072559 CCGAAATATCGAGGTGATGAA pLKO.1 256 CDS 100% 4.950 3.960 N COPS6 n/a
2 TRCN0000291927 CCGAAATATCGAGGTGATGAA pLKO_005 256 CDS 100% 4.950 3.960 N COPS6 n/a
3 TRCN0000072561 CAGTTTGTGAACAAGTTCAAT pLKO.1 932 CDS 100% 5.625 3.938 N COPS6 n/a
4 TRCN0000291926 CAGTTTGTGAACAAGTTCAAT pLKO_005 932 CDS 100% 5.625 3.938 N COPS6 n/a
5 TRCN0000072562 CGTGGAAGAGAAGATTATCAT pLKO.1 301 CDS 100% 5.625 3.938 N COPS6 n/a
6 TRCN0000291928 CGTGGAAGAGAAGATTATCAT pLKO_005 301 CDS 100% 5.625 3.938 N COPS6 n/a
7 TRCN0000072560 CCCTTGTCATTCTCAACATCT pLKO.1 156 CDS 100% 4.950 3.465 N COPS6 n/a
8 TRCN0000291929 CCCTTGTCATTCTCAACATCT pLKO_005 156 CDS 100% 4.950 3.465 N COPS6 n/a
9 TRCN0000072558 CTTGAGAGAAACCGCTGTCAT pLKO.1 1075 3UTR 100% 4.950 3.465 N COPS6 n/a
10 TRCN0000307867 CTTGAGAGAAACCGCTGTCAT pLKO_005 1075 3UTR 100% 4.950 3.465 N COPS6 n/a
11 TRCN0000031296 CCTATGACCAAGCACACAGAT pLKO.1 488 CDS 100% 4.950 2.970 N Cops6 n/a
12 TRCN0000326651 CCTATGACCAAGCACACAGAT pLKO_005 488 CDS 100% 4.950 2.970 N Cops6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006833.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02585 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02585 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467422 TCCTTTCTTTCACTGACCGCTGCG pLX_317 42% 100% 100% V5 n/a
Download CSV